Affirmed Sequences

Sequence NameIMGT NameVersionAlternative namesLocusSequence TypeInference TypeAffirmation LevelSpeciesSpecies subgroupSubgroup typeFull SequenceCoding SequenceGene startGene endUTR 5' StartUTR 5' EndL-PART1 StartL-PART1 EndL-PART2 StartL-PART2 EndCDR1 StartCDR1 EndCDR2 StartCDR2 EndCDR3 Startv_rs_startv_rs_endd_rs_3_prime_startd_rs_3_prime_endd_rs_5_prime_startd_rs_5_prime_endj_rs_startj_rs_endCodon Frame
TRBV19*i011TRBV19*01 A24GTRBVRearranged1Homo sapiensnoneGATGGTGGAATCACTCAGTCCCCGAAGTACCTGTTCAGAAAGGAAGGACAGAATGTGACCCTGAGTTGTGAACAGAATTTGAACCACGATGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGCTGAGATTGATCTACTACTCACAGATAGTAAATGACTTTCAGAAAGGAGATATAGCTGAAGGGTACAGCGTCTCTCGGGAGAAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTAGTA....GATGGTGGAATCACTCAGTCCCCGAAGTACCTGTTCAGAAAGGAAGGACAGAATGTGACCCTGAGTTGTGAACAGAATTTGAACCAC.....................GATGCCATGTACTGGTACCGACAGGACCCAGGGCAAGGGCTGAGATTGATCTACTACTCACAGATA............GTAAATGACTTTCAGAAAGGAGATATAGCT...GAAGGGTACAGCGTCTCTCGGGAG...AAGAAGGAATCCTTTCCTCTCACTGTGACATCGGCCCAAAAGAACCCGACAGCTTTCTATCTCTGTGCCAGTAGTA....128379931451622741
TRBV12-4*i011TRBVUnrearranged and Rearranged1Homo sapiensnoneGATGCTGGAGTTATCCAGTCACCCCGGCACGAGGTGACAGAGATGGGACAAGAAGTGACTCTGAGATGTAAACCAATTTCAGGACATGACTACCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAACAACAACGTTCCGATAGATGATTCAGGGATGCCCGAGGATCGATTCTCAGCTAAGATGCCTAATGCATCATTCTCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTACTTCTGTGCCAGCAGTTTAGCGATGCTGGAGTTATCCAGTCACCCCGGCACGAGGTGACAGAGATGGGACAAGAAGTGACTCTGAGATGTAAACCAATTTCAGGACAT.....................GACTACCTTTTCTGGTACAGACAGACCATGATGCGGGGACTGGAGTTGCTCATTTACTTTAACAAC............AACGTTCCGATAGATGATTCAGGGATGCCCGAGGATCGATTCTCAGCTAAGATGCCT...AATGCATCATTCTCCACTCTGAAGATCCAGCCCTCAGAACCCAGGGACTCAGCTGTGTACTTCTGTGCCAGCAGTTTAGC129079931451622771
TRBV5-6*i011TRBVRearranged1Homo sapiensnoneGACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCATGACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCGATTCTCAGGTCACCAGTTCCCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTGGCTGGGGGACTCGGCCCTCTATCTCTGTGCCAGCAGCTTG.GACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCAT.....................GACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAG............GAGGAAGAGAGACAGAGAGGCAACTTCCCT...GATCGATTCTCAGGTCACCAGTTC...CCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTGGCTGGGGGACTCGGCCCTCTATCTCTGTGCCAGCAGCTTG.128579931451622741
TRBV7-7*i011TRBV7-7*01 C315T, TRBV7-7*01_S0326TRBVUnrearranged and Rearranged1Homo sapiensnoneGGTGCTGGAGTCTCCCAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCATGCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTATGAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCTGAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCTAGCAGCTTAGCGGTGCTGGAGTCTCCCAGTCTCCCAGGTACAAAGTCACAAAGAGGGGACAGGATGTAACTCTCAGGTGTGATCCAATTTCGAGTCAT.....................GCAACCCTTTATTGGTATCAACAGGCCCTGGGGCAGGGCCCAGAGTTTCTGACTTACTTCAATTAT............GAAGCTCAACCAGACAAATCAGGGCTGCCCAGTGATCGGTTCTCTGCAGAGAGGCCT...GAGGGATCCATCTCCACTCTGACGATTCAGCGCACAGAGCAGCGGGACTCAGCCATGTATCGCTGTGCTAGCAGCTTAGC129079931451622771
IGHV1-2*06IGHV1-2*064IGHV1-2*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGACGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGACGGATCAACCCTAAC......AGTGGTGGCACAAACTATGCACAGAAGTTTCAG...GGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAG.12957699151174289
IGHV1-3*04IGHV1-3*046IGHV1-3*i01IGHVRearranged Only1Homo sapiensCAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACACTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGCAGGTCCAGCTTGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACACTGGC......AATGGTAACACAAAATATTCACAGAAGTTCCAG...GGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAG.12957699151174289
IGHV1-58*03IGHV1-58*033IGHV1-58*i01IGHVRearranged Only1Homo sapiensCAAATGCAGCTGGTGCAGTCTGGGCCTGAAGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTTACTAGCTCTGCTGTGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGACAAATGCAGCTGGTGCAGTCTGGGCCT...GAAGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTT............ACTAGCTCTGCTGTGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGC......AGTGGTAACACAAACTACGCACAGAAGTTCCAG...GAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAG.12957699151174289
IGHV1-69*i043IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCAGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCAGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAG.12957699151174289
IGHV1-69*18IGHV1-69*182IGHV1-69*i02IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAG.12957699151174289
IGHV1-69*20IGHV1-69*202IGHV1-69*i03IGHVRearranged Only1Homo sapiensCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCTTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......TTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAG.12957699151174289
IGHV2-70*20IGHV2-70*202IGHV2-70*i01IGHVRearranged Only1Homo sapiensCAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGTGTGTGAGCTGGGTCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACTCATTGATTGGGATGATGATAAATACTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGACAGGTCACCTTGAGGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGTGTGTGAGCTGGGTCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACTCATTGATTGGGAT.........GATGATAAATACTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGA...129876105157177292
IGHV3-21*05IGHV3-21*053IGHV3-21*i01IGHVRearranged Only1Homo sapiensGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACATATACTACGCAGACTCAGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG.12957699151174289
IGHV3-21*07IGHV3-21*072IGHV3-21*i02IGHVRearranged Only1Homo sapiensGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT......GGTAGTACCATATACTACGCAGACTCAGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA12967699151174289
IGHV3-30*20IGHV3-30*202IGHV3-30*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGCAATAAATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAG.12957699151174289
IGHV3-30*i022IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAG.12957699151174289
IGHV3-33*08IGHV3-33*082IGHV3-33*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAG.12957699151174289
IGHV3-43D*04IGHV3-43D*043IGHV3-43D*i01IGHVRearranged Only1Homo sapiensGAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGATGAAGTGCAGCTGGTGGAGTCTGGGGGA...GTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGAT......GGTGGTAGCACATACTATGCAGACTCTGTGAAG...GGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGAT.12977699151174289
IGHV3-53*05IGHV3-53*053IGHV3-53*i01IGHVRearranged Only1Homo sapiensGAGGTGCAGCTGGTGGAGACTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCCGTGTATTACTGTGCGAGAGAGAGGTGCAGCTGGTGGAGACTGGAGGA...GGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCCGTGTATTACTGTGCGAGAG.12927699151171286
IGHV3-7*04IGHV3-7*045IGHV3-7*i01IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGGAAGATTGAGTGTGTGTGGATATGAGTGTGAGAAACAGTGGATTTGTGTGTCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAAGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGGGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAAGGGCTGGAGTGGGTGGCCAACATAAAGCAAGAT......GGAAGTGAGAAATACTATGTGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGGG.161455146150160236259311334449457495
IGHV3-9*04IGHV3-9*042IGHV3-9*i01IGHVGenomic and rearranged1Homo sapiensGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAGATAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAAT......AGTGGTAGCATAGGCTATGCGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG...12957699151174289
IGHV4-30-4*08IGHV4-30-4*085IGHV4-30-4*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGATTACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTGATTACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAG.129876105157177292
IGHV4-31*11IGHV4-31*114IGHV4-31*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAG.129876105157177292
IGHV4-39*08IGHV4-39*082IGHV4-39*i01IGHVRearranged Only1Homo sapiensCAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACGTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGACACAGCTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACGTGCACTGTCTCTGGTGGCTCCATCAGC......AGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGAC.129876105157177292
IGHV4-39*09IGHV4-39*092IGHV4-39*i02IGHVRearranged Only1Homo sapiensCAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAGACAGCTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.129876105157177292
IGHV4-39*i033IGHVRearranged Only1Homo sapiensCAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCAAGACCAGCTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCAAGAC.129876105157177292
IGHV4-4*03IGHV4-4*033IGHV4-4*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTCCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTCCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC.........AGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGT.........GGGAGCACCAACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAG.129576102154174289
IGHV4-4*09IGHV4-4*092IGHV4-4*i02IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATACCAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGA..12917699151171286
IGHV4-59*11IGHV4-59*112IGHV4-59*i02IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTCACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTCACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.12927699151171286
IGHV4-59*12IGHV4-59*124IGHV4-59*i01IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAG.12927699151171286
IGHV4-59*i032IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTAAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTAAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.12927699151171286
IGHV4-61*10IGHV4-61*102IGHV4-61*i02IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGC......AGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.129876105157177292
IGHV4-61*11IGHV4-61*112IGHV4-61*i03IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAG.129876105157177292
IGHV4-61*i042IGHVRearranged Only1Homo sapiensCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGC......AGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.129876105157177292
IGHD1-1*01IGHD1-1*011IGHDGenomic Only1Homo sapiensAGATTCTGAACAGCCCCGAGTCACGGTGGGTACAACTGGAACGACCACCGTGAGAAAAACTGTGTCCAAAACTGGTACAACTGGAACGAC29454673128
IGHD1-14*01IGHD1-14*011IGHDGenomic Only1Homo sapiensGGATTCCGAACAGCCCCGAGTCACAGCGGGTATAACCGGAACCACCACTGTCAGAATAGCTACGTCAAAAACTGGTATAACCGGAACCAC29454673128
IGHD1-20*01IGHD1-20*011IGHDGenomic Only1Homo sapiensGGATTCTGAACAGCCCCGAGTCACAGTGGGTATAACTGGAACGACCACCGTGAGAAAAACTGTGTCCAAAACTGGTATAACTGGAACGAC29454673128
IGHD1-26*01IGHD1-26*011IGHDGenomic and rearranged1Homo sapiensGGATTCTGAACAGCCCCGAGTCACGGTGGGTATAGTGGGAGCTACTACCACTGTGAGAAAAGCTATGTCCAAAACTGGTATAGTGGGAGCTACTAC29484976128
IGHD1-7*01IGHD1-7*011IGHDGenomic Only1Homo sapiensGGATTCTGAACAGCCCCGAGTCACAGTGGGTATAACTGGAACTACCACTGTGAGAAAAGCTTCGTCCAAAACGGGTATAACTGGAACTAC29454673128
IGHD2-15*01IGHD2-15*011IGHDGenomic and rearranged1Homo sapiensGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTGGTGGTAGCTGCTACTCCCACAGTGACACAGACCCATTCCCAAAGCAGGATATTGTAGTGGTGGTAGCTGCTACTCC29596087128
IGHD2-2*01IGHD2-2*011IGHDGenomic Only1Homo sapiensGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATGCCCACAGTGACACAGCCCCATTCCCAAAGCAGGATATTGTAGTAGTACCAGCTGCTATGCC29596087128
IGHD2-2*02IGHD2-2*021IGHDGenomic Only1Homo sapiensGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTAGTAGTACCAGCTGCTATACCCACAGTGACACAGCCCCATTCCCAAAGCAGGATATTGTAGTAGTACCAGCTGCTATACC29596087128
IGHD2-21*02IGHD2-21*021IGHDGenomic and rearranged1Homo sapiensGGATTTTGTGGGGGTTCGTGTCACTGTGAGCATATTGTGGTGGTGACTGCTATTCCCACAGTGACACAACCCCATTCCTAAAGCAGCATATTGTGGTGGTGACTGCTATTCC29565784128
IGHD2-8*01IGHD2-8*011IGHDGenomic and rearranged1Homo sapiensGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTACTAATGGTGTATGCTATACCCACAGTGACACAGCCCCATTCCCAAAGCAGGATATTGTACTAATGGTGTATGCTATACC29596087128
IGHD3-10*01IGHD3-10*011IGHDGenomic and rearranged1Homo sapiensGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACTATGGTTCGGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCGTATTACTATGGTTCGGGGAGTTATTATAAC29596087128
IGHD3-16*02IGHD3-16*021IGHDGenomic and rearranged1Homo sapiensGGTTTGAAGTGAGGTCTGTGTCACTGTGGTATTATGATTACGTTTGGGGGAGTTATCGTTATACCCACAGCATCACACGGTCCATCAGAAACCGTATTATGATTACGTTTGGGGGAGTTATCGTTATACC29656693128
IGHD3-22*01IGHD3-22*011IGHDGenomic and rearranged1Homo sapiensGGTTTGAAGTGAGGTCTGTGTCACTGTGGTATTACTATGATAGTAGTGGTTATTACTACCACAGTGTCACAGAGTCCATCAAAAACTGTATTACTATGATAGTAGTGGTTATTACTAC29596087128
IGHD3-3*01IGHD3-3*011IGHDGenomic and rearranged1Homo sapiensGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACGATTTTTGGAGTGGTTATTATACCCACAGTGTCACAGAGTCCATCAAAAACCGTATTACGATTTTTGGAGTGGTTATTATACC29596087128
IGHD3-9*01IGHD3-9*011IGHDGenomic and rearranged1Homo sapiensGGTTTAGAATGAGGTCTGTGTCACTGTGGTATTACGATATTTTGACTGGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCGTATTACGATATTTTGACTGGTTATTATAAC29596087128
IGHD4-11*01IGHD4-11*011IGHDGenomic Only1Homo sapiensGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACAGTAACTACCACAGTGATGAACCCAGCAGCAAAAACTTGACTACAGTAACTAC29444572128
IGHD4-17*01IGHD4-17*011IGHDGenomic and rearranged1Homo sapiensGCTTTTTGTGAAGGCCCCTCCTACTGTGTGACTACGGTGACTACCACAGTGATGAAACTAGCAGCAAAAACTTGACTACGGTGACTAC29444572128
IGHD4-23*01IGHD4-23*011IGHDGenomic and rearranged1Homo sapiensGCTTTTTGTGAAGGGCCCTCCTGCTGTGTGACTACGGTGGTAACTCCCACAGTGATGAAACCAGCAGCAAAAACTTGACTACGGTGGTAACTCC29474875128
IGHD4-4*01IGHD4-4*011IGHDGenomic Only1Homo sapiensGCTTTTTGTGAAGGGTCCTCCTACTGTGTGACTACAGTAACTACCACAGTGATGAACCCAGCAGCAAAAACTTGACTACAGTAACTAC29444572128
IGHD5-12*01IGHD5-12*011IGHDGenomic and rearranged1Homo sapiensGGTTATTGTCAGGCGATGTCAGACTGTGGTGGATATAGTGGCTACGATTACCACAGTGGTGCCGCCCATAGCAGCAACCGTGGATATAGTGGCTACGATTAC29515279128
IGHD5-18*01IGHD5-18*011IGHDGenomic Only1Homo sapiensGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGGTTACCACAGTGGTGCTGCCCATAGCAGCAACCGTGGATACAGCTATGGTTAC29484976128
IGHD5-24*01IGHD5-24*011IGHDGenomic and rearranged1Homo sapiensGGTTATTGTCAGGGGGTGCCAGGCCGTGGTAGAGATGGCTACAATTACCACAGTGGTGCCGCCCATAGCAGCAACCGTAGAGATGGCTACAATTAC29484976128
IGHD5-5*01IGHD5-5*011IGHDGenomic Only1Homo sapiensGGTTATTGTCAGGGGGTGTCAGACTGTGGTGGATACAGCTATGGTTACCACAGTGGTGCTGCCCATAGCAGCAACCGTGGATACAGCTATGGTTAC29484976128
IGHD6-13*01IGHD6-13*011IGHDGenomic and rearranged1Homo sapiensGGTTTCTGAAGGTGTCTGTGTCACAGTGGGGTATAGCAGCAGCTGGTACCACAGTGACACTCACCCAGCCAGAAACCGGGTATAGCAGCAGCTGGTAC29495077128
IGHD6-19*01IGHD6-19*011IGHDGenomic and rearranged1Homo sapiensGGTTTCTGAAGCTGTCTGTATCACAGTGGGGTATAGCAGTGGCTGGTACCACAGTGACACTCGCCAGGCCAGAAACCGGGTATAGCAGTGGCTGGTAC29495077128
IGHD6-25*01IGHD6-25*011IGHDGenomic Only1Homo sapiensGGTTTCTGAAGCTGTCTGTGTCACAGTCGGGTATAGCAGCGGCTACCACAATGACACTGGGCAGGACAGAAACCGGGTATAGCAGCGGCTAC29464774128
IGHD6-6*01IGHD6-6*011IGHDGenomic and rearranged1Homo sapiensAGTTTCTGAAGGTGTCTGTGTCACAGTGGAGTATAGCAGCTCGTCCCACAGTGACACTCGCCAGGCCAGAAACCGAGTATAGCAGCTCGTCC29464774128
IGHD7-27*01IGHD7-27*011IGHDGenomic Only1Homo sapiensGGTTTTGGCTGAGCTGAGAACCACTGTGCTAACTGGGGACACAGTGATTGGCAGCTCTACAAAAACCCTAACTGGGGA29394067128
IGHJ1*01IGHJ1*011IGHJGenomic and rearranged1Homo sapiensGGTTTCTGTAGCCCCTGGCTCAGGGCTGACTCACCGTGGCTGAATACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAGGCTGAATACTTCCAGCACTGGGGCCAGGGCACCCTGGTCACCGTCTCCTCAG39901380
IGHJ2*01IGHJ2*011IGHJGenomic and rearranged1Homo sapiensTGTTTTTGTATGGGAGAAGCAGGAGGGCAGAGGCTGTGCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAGCTACTGGTACTTCGATCTCTGGGGCCGTGGCACCCTGGTCACTGTCTCCTCAG39911381
IGHJ3*02IGHJ3*021IGHJGenomic and rearranged1Homo sapiensGGTTTGTGTCTGGGCAGGAACAGGGACTGTGTCCCTGTGTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGTGATGCTTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAG40891391
IGHJ4*02IGHJ4*021IGHJGenomic and rearranged1Homo sapiensGGTTTTTGTGCACCCCTTAATGGGGCCTCCCACAATGTGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGACTACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG40871392
IGHJ5*02IGHJ5*021IGHJGenomic and rearranged1Homo sapiensAGTTCTTGCCTGGGGTCCTGGCATTGTTGTCACAATGTGACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGACAACTGGTTCGACCCCTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAG40901392
IGHJ6*02IGHJ6*021IGHJGenomic and rearranged1Homo sapiensGGTTTTTGTGGGGTGAGGATGGACATTCTGCCATTGTGATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGATTACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAG391011382
IGHJ6*03IGHJ6*031IGHJGenomic and rearranged1Homo sapiensGGTTTTTGTGGGGTGAGGATGGACATTCTGCCATTGTGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAGATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACGGTCACCGTCTCCTCAG391011382
IGHV1-18*01IGHV1-18*011IGHVGenomic and rearranged1Homo sapiensCAAACACCCCTCCTTGGGAGAATCCCCTAGATCACAGCTCCTCACCATGGACTGGACCTGGAGCATCCTTTTCTTGGTGGCAGCACCAACAGGTAACGGACTCCCCAGTCCCAGGGCTGAGAGAGAAACCAGGCCAGTCATGTGAGACTTCACCCACTCCTGTGTCCTCTCCACAGGTGCCCACTCCCAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGGGTTTCAGAAACCCAGGTTCAGCTGGTGCAGTCTGGAGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTT............ACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTAC......AATGGTAACACAAACTATGCACAGAAGCTCCAG...GGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA188483177187263286338361476484522
IGHV1-18*03IGHV1-18*031IGHVGenomic Only1Homo sapiensTCTCCACAGGTGCCCACTCCCAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACATGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTCTCGCGACAGGTTCAGCTGGTGCAGTCTGGAGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTT............ACCAGCTATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTAC......AATGGTAACACAAACTATGCACAGAAGCTCCAG...GGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACATGGCCGTGTATTACTGTGCGAGAGA21316102096119171194309317346
IGHV1-18*04IGHV1-18*041IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGCATCCTTTTCTTGGTGGCAGCAGCAACAGGTAACGGACTCCCCAGTCCCAGGGCTGAGAGAGAAACCAGGCCAGTCATGTGAGACTTCACCCACTCCTGTGTCCTCTCCACAGGTGCCCACTCCCAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTACCAGCTACGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGGGTTTCAGAAACCCAGGTTCAGCTGGTGCAGTCTGGAGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTT............ACCAGCTACGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTAC......AATGGTAACACAAACTATGCACAGAAGCTCCAG...GGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA142437146131141217240292315430438476
IGHV1-2*02IGHV1-2*021IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAGGTAAGAGGCTCCCTAGTCCCAGTGATGAGAAAGAGATTGAGTCCAGTCCAGGGAGATCTCATCCACTTCTGTGTTCTCTCCACAGGAGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGGGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAAC......AGTGGTGGCACAAACTATGCACAGAAGTTTCAG...GGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-2*07IGHV1-2*071IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAGGTAAGAGGCTCCCTAGTCCCAGTGATGAGAAAGAGATTGAGTCCAGTCCAGGGAGATCTCATCCACTTCTGTGTTCTCTCCACAGGAGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACATAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGGGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAAC......AGTGGTGGCACAAACTATGCACATAAGTTTCAG...GGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-24*01IGHV1-24*011IGHVGenomic and rearranged1Homo sapiensCCCAGAGACCATCACACAACAGCCACATCCCTCCCCTACAGAAGCCCCCAGAGCGCAGCACCTCACCATGGACTGCACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAGGCAAGAGAATCCTGAGTTCCAGGTCTGATGAGGGGACTGGGTCCAGTTAAGTGGTGTCTCATCCACTCCTCTGTCCTCTCCACAGGCACCCACGCCCAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGTTTCCGGATACACCCTCACTGAATTATCCATGCACTGGGTGCGACAGGCTCCTGGAAAAGGGCTTGAGTGGATGGGAGGTTTTGATCCTGAAGATGGTGAAACAATCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCAACAGACACAGTGTGAAAACCCACATCCTGAGAGCGTCAGAAACCCAGGTCCAGCTGGTACAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGTTTCCGGATACACCCTC............ACTGAATTATCCATGCACTGGGTGCGACAGGCTCCTGGAAAAGGGCTTGAGTGGATGGGAGGTTTTGATCCTGAA......GATGGTGAAACAATCTACGCACAGAAGTTCCAG...GGCAGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCAACAGA210505199209285308360383498506544
IGHV1-3*01IGHV1-3*011IGHVGenomic and rearranged1Homo sapiensGATCCTCTTTTTGGTGGCAGCAGCCACAGGTAAGGGGCTGCCAAATCCCAGTGAGGAGGAAGGGATCGAGGCCAGTCAAGGGGAATTCCATCCACTCCTGTGTCTTCTCTACAGGTGCCCACTCCCAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACCAGGTCCAGCTTGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACGCTGGC......AATGGTAACACAAAATATTCACAGAAGTTCCAG...GGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGA126421115125201224276299414422450
IGHV1-3*02IGHV1-3*021IGHVGenomic Only1Homo sapiensATGGACTGGACCTGGAGGATCCTCTTTTTGGTGGCAGCAGCCACAGGTAAGGGGCTGCCAAATCCCAGTGAGGAGGAAGGGATCGAAGCCAGTCAAGGGGGCTTCCATCCACTCCTGTGTCTTCTCTACAGGTGTCCACTCCCAGGTTCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGAGCAACGCTGGCAATGGTAACACAAAATATTCACAGGAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACATGGCTGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACCCAGGTTCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGAGCAACGCTGGC......AATGGTAACACAAAATATTCACAGGAGTTCCAG...GGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACATGGCTGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-3*05IGHV1-3*051IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGATCCTCTTTTTGGTGGCAGCAGCCACAGGTAAGGGGCTGCCAAATCCCAGTGAGGAGGAAGGGATCGAGGCCAGTCAAGGGGAATTCCATCCACTCCTGTGTCTTCTCTACAGGTGCCCACTCCCAGGTCCAGCTTGTGCAGTCTGGGGCTGAGGAGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACGCTGGCAATGGTAACACAAAATATTCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACCCAGGTCCAGCTTGTGCAGTCTGGGGCT...GAGGAGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGATCAACGCTGGC......AATGGTAACACAAAATATTCACAGAAGTTCCAG...GGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCTGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-45*02IGHV1-45*021IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGAATCCTCTTCTTGGTGGCAGCAGCCACAGGTAAGGGGCTCCCAAGTCCCAGTGATGAGGAGGGGATTGAGTCCAGTCAAGGTGGCTTTTATCCACTCCTGTGTCCCCTCCACAGATGCCTACTCCCAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTTCCGGATACACCTTCACCTACCGCTACCTGCACTGGGTGCGACAGGCCCCCGGACAAGCGCTTGAGTGGATGGGATGGATCACACCTTTCAATGGTAACACCAACTACGCACAGAAATTCCAGGACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGATACACAGTGTGAAAACCCACATCCTGAGACCGTCAGAAACCCAGATGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTTCCGGATACACCTTC............ACCTACCGCTACCTGCACTGGGTGCGACAGGCCCCCGGACAAGCGCTTGAGTGGATGGGATGGATCACACCTTTC......AATGGTAACACCAACTACGCACAGAAATTCCAG...GACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGATA143438146132142218241293316431439477
IGHV1-45*03IGHV1-45*031IGHVGenomic and rearranged1Homo sapiensAATCCTCTTCTTGGTGGCAGCAGCCACAGGTAAGGGGCTCCCAAGTCCCAGTGATGAGGAGGGGATTGAGTCCAGTCAAGGTGGCTTTTATCCACTCCTGTGTCCCCTCCACAGATGCCTACTCCCAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTTCCGGATACACCTTCACCTACCGCTACCTGCACTGGGTGCGACAGGCCCCCAGACAAGCGCTTGAGTGGATGGGATGGATCACACCTTTCAATGGTAACACCAACTACGCACAGAAATTCCAGGACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGATACACAGTGTGAAAACCCACCAGATGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTTCCGGATACACCTTC............ACCTACCGCTACCTGCACTGGGTGCGACAGGCCCCCAGACAAGCGCTTGAGTGGATGGGATGGATCACACCTTTC......AATGGTAACACCAACTACGCACAGAAATTCCAG...GACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGATA126421115125201224276299414422450
IGHV1-46*01IGHV1-46*011IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGGTCTTCTGCTTGCTGGCTGTAGCTCCAGGTAAAGGGCCAACTGGTTCCAGGGCTGAGGAAGGGATTTTTTCCAGTTTAGAGGACTGTCATTCTCTACTGTGTCCTCTCCGCAGGTGCTCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAGAAACCACATCCTCAGAGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTC............ACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGT......GGTGGTAGCACAAGCTACGCACAGAAGTTCCAG...GGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-46*03IGHV1-46*031IGHVGenomic and rearranged1Homo sapiensGGTCTTCTGCTTGCTGGCTGTAGCTCCAGGTAAAGGGCCAACTGGTTCCAGGGCTGAGGAAGGGATTTTTTCCAGTTTAGAGGACTGTCATTCTCTACTGTGTCCTCTCCGCAGGTGCTCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGACACAGTGTGAAAACCCACCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTC............ACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGT......GGTGGTAGCACAAGCTACGCACAGAAGTTCCAG...GGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCTAGAGA126421115125201224276299414422450
IGHV1-46*04IGHV1-46*041IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGGTCTTCTGCTTGCTGGCTGTAGCTCCAGGTAAAGGGCCAACTGGTTCCAGGGCTGAGGAAGGGATTTTTTCCAGTTTAGAGGACTGTCATTCTCTACTGTGTCCTCTCCGCAGGTGCTCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTCACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGTGGTGGTAGCACAAGCTACGCACAGAAGTTGCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAGAAACCACATCCTCAGAGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCATCTGGATACACCTTC............ACCAGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATCAACCCTAGT......GGTGGTAGCACAAGCTACGCACAGAAGTTGCAG...GGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA143438146132142218241293316431439477
IGHV1-69-2*01IGHV1-69-2*011IGHVGenomic and rearranged1Homo sapiensATCCCTCCCCTACAGAAGCCCCCAGAGAGCAGCACCTCACCATGGACTGCACCTGGAGGATCCTCCTCTTGGTGGCAGCAGCTACAGGTAAGAGAATCCTTAGTTCCAGGGCTGATGAGGGGACTGGGTCCAGTTAAGTGGTGTCTCATCCACTCCTTTCTCTTCTCCACAGGCACCCACGCCGAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCTACAGTGAAAATCTCCTGCAAGGTTTCTGGATACACCTTCACCGACTACTACATGCACTGGGTGCAACAGGCCCCTGGAAAAGGGCTTGAGTGGATGGGACTTGTTGATCCTGAAGATGGTGAAACAATATACGCAGAGAAGTTCCAGGGCAGAGTCACCATAACCGCGGACACGTCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCAACAGACACAGTGTGAAAACCCACATGCTGAGAGTGTGAGGTCCAGCTGGTACAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCTACAGTGAAAATCTCCTGCAAGGTTTCTGGATACACCTTC............ACCGACTACTACATGCACTGGGTGCAACAGGCCCCTGGAAAAGGGCTTGAGTGGATGGGACTTGTTGATCCTGAA......GATGGTGAAACAATATACGCAGAGAAGTTCCAG...GGCAGAGTCACCATAACCGCGGACACGTCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCAACAGA184479173183259282334357472480510
IGHV1-69*01IGHV1-69*011IGHVGenomic and rearranged1Homo sapiensATTCCTCCTCTAAAGAAGCCCCTGGGAGCACAGCTCATCACCATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA186481175185261284336359474482512
IGHV1-69*02IGHV1-69*021IGHVGenomic and rearranged1Homo sapiensGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTCCAGCTGGTGCAATCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATACTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCCTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACCAGGTCCAGCTGGTGCAATCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATACTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......CTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA127422116126202225277300415423451
IGHV1-69*04IGHV1-69*041IGHVGenomic and rearranged1Homo sapiensCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCCTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......CTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA12967699151174289
IGHV1-69*06IGHV1-69*061IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA144439146133143219242294317432440478
IGHV1-69*09IGHV1-69*091IGHVGenomic and rearranged1Homo sapiensCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCCTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......CTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA12967699151174289
IGHV1-69*10IGHV1-69*101IGHVGenomic and rearranged1Homo sapiensTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTCCCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCCTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......CTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA973928696172195247270385393415
IGHV1-69*12IGHV1-69*121IGHVGenomic and rearranged1Homo sapiensGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTCCCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACCAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA127422116126202225277300415423451
IGHV1-69*14IGHV1-69*141IGHVGenomic Only1Homo sapiensATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACCCAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA144439146133143219242294317432440478
IGHV1-69*17IGHV1-69*171IGHVGenomic and rearranged1Homo sapiensGAGATAAATATAGATATATTGGTGCCCTGAGAGCATCACATAACAACCACATTCCTCCTCTGAAGAAGCCCCTGGGAGCACAGCTCATCACCATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTATAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTATAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA236531225235311334386409524532560
IGHV1-69*19IGHV1-69*191IGHVGenomic and rearranged1Homo sapiensCCATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGATGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGACAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGATGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA146441135145221244296319434442464
IGHV1-69D*01IGHV1-69D*011IGHVGenomic Only1Homo sapiensATGGACTGGACCTGGAGGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTCTCCACAGGTGTCCAGTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA144439146133143219242294317432440478
IGHV1-8*01IGHV1-8*011IGHVGenomic and rearranged1Homo sapiensCACTCCACCAACCACATCTGTCCTCTAGAGAAAACCCTGTGAGCACACCTCCTCACCATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCTACAAGTAAGGGGCTTCCTAGTCTCAAAGCTGAGGAACGGATCCTGGTTCAGTCAAAGAGGATTTTATTCTCTCCTGTGTTCTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCAGTTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAACAGTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGCACAGTGTGAAAAACCACATCCTCAGAGAGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCAGTTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAAC......AGTGGTAACACAGGCTATGCACAGAAGTTCCAG...GGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGG201496190200276299351374489497535
IGHV1-8*02IGHV1-8*021IGHVGenomic Only1Homo sapiensGATCCTCTTCTTGGTGGCAGCAGCTACAAGTAAGGGGCTTCCTAGTCTCAAAGCTGAGGAACGGATCCTGGTTCAGTCAAAGAGGATTTTATTCTCTCCTGTGTCCTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCAGCTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAACAGTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGCACAGTGTGAAAAACCACCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCAGCTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAAC......AGTGGTAACACAGGCTATGCACAGAAGTTCCAG...GGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGG127422116126202225277300415423451
IGHV1-8*03IGHV1-8*031IGHVGenomic and rearranged1Homo sapiensGATCCTCTTCTTGGTGGCAGCAGCTACAAGTAAGGGGCTTCCTAGTCTCAAAGCTGAGGAACGGATCCTGGTTCAGTCAAAGAGGATTTTATTCTCTCCTGTGTCCTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCAGCTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAACAGTGGTAACACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATTACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGGCACAGTGTGAAAAACCACCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCAGCTATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATGAACCCTAAC......AGTGGTAACACAGGCTATGCACAGAAGTTCCAG...GGCAGAGTCACCATTACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGG127422116126202225277300415423451
IGHV2-26*01IGHV2-26*011IGHVGenomic and rearranged1Homo sapiensAGTGACTCCTGTGCCCCACCATGGACACACTTTGCTACACACTCCTGCTGCTGACCACCCCTTCCTGTGAGTGCTGTGGTCAGGGACTTCCTCAGAAGTGAAACATCAGTTGTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTGTCCCAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACGAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATACCACAGAGACACAGCCCAGGATGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGC......AATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAAT.........GACGAAAAATCCTACAGCACATCTCTGAAG...AGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATAC164464153163239268320340455465503
IGHV2-5*01IGHV2-5*011IGHVGenomic and rearranged1Homo sapiensATGGACACACTTTGCTCCACGCTCCTGCTGCTGACCATCCCTTCATGTGAGTGCTGTGGTCAGGGACTCCTTCACGGGTGAAACATCAGTTTTCTTGTTTGTGGGCTTCATCTTCTTATGCTTTCTCCACAGGGGTCTTGTCCCAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACAGACCACAAAGACACAGCCCAGGGCACCTCCTGTACAAAAACCCAGATCACCTTGAAGGAGTCTGGTCCT...ACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGAAT.........GATGATAAGCGCTACAGCCCATCTCTGAAG...AGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACAGAC144444146133143219248300320435445483
IGHV2-5*02IGHV2-5*021IGHVGenomic and rearranged1Homo sapiensTCCTCTGGGTTGAAAAAGCCGAGCACAGGTCCCAGCTCAGTGACTCCTGTGCCCCACCATGGACACACTTTGCTCCACGCTCCTGCTGCTGACCATCCCTTCATGTGAGTGCTGTGGTCAGGGACTCCTTCATGGGTGAAACATCAGTTTTCTTGTTTGTGGGCTTCATCTTCTTATGCTTTCTCCACAGGGGTCTTGTCCCAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGATGATGATAAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACAGACCACAAAGACACAGCCCAGGGCACCTCCTGTACAAAAACCCAGATCACCTTGAAGGAGTCTGGTCCT...ACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAGTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATTTATTGGGAT.........GATGATAAGCGCTACAGCCCATCTCTGAAG...AGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACACAGAC202502191201277306358378493503541
IGHV2-70*01IGHV2-70*011IGHVGenomic and rearranged1Homo sapiensATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACTCATTGATTGGGATGATGATAAATACTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGACACAGCCCAGGGCGCCTCCTGTACAACAGGTCACCTTGAGGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACTCATTGATTGGGAT.........GATGATAAATACTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC144444146133143219248300320435445478
IGHV2-70*15IGHV2-70*151IGHVGenomic and rearranged1Homo sapiensTCCCCTGGGTTCAAAAGACGAGGACAGGGCCTCGCTCAGTGAATCCTGCTCCCCACCATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATACTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGGCACAGCCCAGGGCGCCTCCTGTACAAGAACCCAGGTCACCTTGAGGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGAT.........GATGATAAATACTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC201501190200276305357377492502540
IGHV2-70D*04IGHV2-70D*041IGHVGenomic and rearranged1Homo sapiensTCTCCTGGGTTCAAAAGACGAGGACAGGGCCTCGCTCAGTGAATCCTGCTCTCCACCATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGACACAGCCCAGGGCGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGAT.........GATGATAAATTCTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC201501190200276305357377492502540
IGHV2-70D*14IGHV2-70D*141IGHVGenomic Only1Homo sapiensATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGTAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGACACAGCCCAGGGCGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGTAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGAT.........GATGATAAATTCTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC144444146133143219248300320435445483
IGHV3-11*01IGHV3-11*011IGHVGenomic and rearranged1Homo sapiensCCAGGAGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATAATAAAAGGTGATTTATGGAGAACTAGAGACATTGAGTGGACGTGAGTGAGATAAGCAGTGAATATATGTGGCAGTTTCTGACTAGGTTGTCTCTGTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......GGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA202497191201277300352375490498536
IGHV3-11*04IGHV3-11*041IGHVGenomic and rearranged1Homo sapiensGTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGCTCGCGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......GGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA22317112197120172195310318346
IGHV3-11*05IGHV3-11*051IGHVGenomic and rearranged1Homo sapiensCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTTACACAAACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGCTCGCGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA22317112197120172195310318346
IGHV3-11*06IGHV3-11*061IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTATAAAAGGTGATTTATGGAGAACTAGAGACATTGAGTGGACGTGAGTGAGATAAGCAGTGAATATATGTGGCAGTTTCTGACCAGGTTGTCTCTGTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTTACACAAACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTTACACAAACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA155450146144154230253305328443451489
IGHV3-13*01IGHV3-13*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATATTAGAAGGTGATTCATGGAGAACTAGAGATATTGAGTGTGAATGGGCATGAATGAGAGAAACAGTGGGTATGTGTGGCAATTTCTGACTTTTGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAAGTCAGTATGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCT.........GGTGACACATACTATCCAGGCTCCGTGAAG...GGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGA161453146150160236259311331446454492
IGHV3-13*04IGHV3-13*041IGHVGenomic and rearranged1Homo sapiensTCGCGAGTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAATGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAGGTCAGTGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAATGGGTCTCAGCTATTGGTACTGCT.........GGTGACACATACTATCCAGGCTCCGTGAAG...GGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGA293211828104127179199314322350
IGHV3-13*05IGHV3-13*051IGHVGenomic and rearranged1Homo sapiensCTCAGATGTCCCACCCCAGAGCTTGCTATATAGTAACAGACATGCAAATAGTTGACTCCCTCTCCTGATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGTGGAGCCCCAGCCTTGGGATTCCCAAGTGTTTGTATTCAGTGATCAGGACTGAACACACAGGACTCACCATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATATTAGAAGGTGATTCATGGAGAACTAGAGATATTGAGTGTGAATGGGCATGAATGAGAGAAACAGTGGGTATGTGTGGCAATTTCTGACTTTTGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACCCATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAAGTCAGTATGAGCCCAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCT.........GGTGACCCATACTATCCAGGCTCCGTGAAG...GGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGAGA336628325335411434486506621629659
IGHV3-15*01IGHV3-15*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGATTTTCCTTGCTGCTATTTTAAAAGGTGATTTATGGAGAACTAGAGAGATTAAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGATCTTAGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGACACAGTGAGGGGAGGTCAGTGTGAGCCCGGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCTCTGGATTCACTTTC............AGTAACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGA161462146150160236259311340455463501
IGHV3-15*07IGHV3-15*071IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGATTTTCCTTGCTGCTATTTTAAAAGGTGATTTATGGAGAACTAGAGAGATTAAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGATCTTAGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCTCTGGTTTCACTTTCAGTAACGCCTGGATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCTCTGGTTTCACTTTC............AGTAACGCCTGGATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCGGCCGTATTAAAAGCAAAACTGATGGTGGGACAACAGACTACGCTGCACCCGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACAGA161462146150160236259311340455463501
IGHV3-16*02IGHV3-16*021IGHVGenomic Only1Homo sapiensATGGAATTTGGGCTGAGCTGGGTTTTTCTTGCTGGTATTTTAAAAGGTGATTCATGGAGAACTAAGGATATTGAGTGAGTGGACATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGTGGACTCCGTGAAGCGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAATCCTGTGAGGGGACACAAGTGCGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGTGGACTCCGTGAAG...CGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAA159454146148158234257309332447455493
IGHV3-19*01IGHV3-19*011IGHVGenomic and rearranged1Homo sapiensCAAGACACTAAGGGCTCCTCACCCAACCCCCTTTCGTGAGGAGTTGGCCTGGGTAAACAGATCCTCAGCATTTCAAAGGAGCCCAATTAACTGATAAGGTACCCACACCAACAATGTATGAAGTTCCCAGGAATTTTCTCCAAGAGATAACAACATGAAACCTTGAGTTTGTGTCCGGCATAGACCCTATATCTAATTATAATAAAAGATTTAGAACCTTGCACCTGGTACCGTTGCTCTTCTTGTAACCATTTGTCTTTTAAGTTGTTTATCACTCTGTAACTATTTTGATTATTTTGATTCTTGCATGTTTTTACTTCTGTAAAATTATTACATTTGAGTCCCTCTCCCCTTCCTAAACCTAGGTATAAAATTTACTCGAGCCCCTTCCTCGTGGCCGAGAGAATTTTGAGCATGAGCTGTCTCTTTGGCAGCCGGCTTAATAAAGGACTCTTAATTCGTCTCAAAGTGTGGCGTTTTCTTAACTCACCTGGGTACAACAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAGAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGCAGACTCTGTGAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTTCCTGTATCAGCAAATGAACAGCCTGAGGCCCGAGGACATGGCTGTGTATTACTGTGTGAGAAACACTGTGAGAGGACGGAAGTGTGAGCCCAGACACAAACCACAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAGAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGTCCGCCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGCAGACTCTGTGAAG...GGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTTCCTGTATCAGCAAATGAACAGCCTGAGGCCCGAGGACATGGCTGTGTATTACTGTGTGAGAAA500795489499575598650673788796834
IGHV3-20*01IGHV3-20*011IGHVGenomic and rearranged1Homo sapiensGGACTCGCCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGATCAATAGAGATGTTGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAATGGTGGTAGCACAGGTTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGAGACACAGTGAGGGGAAGCCAGTGAGAGCCCAGACACAAACGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGAGA170465159169245268320343458466504
IGHV3-20*04IGHV3-20*041IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGATCAATAGAGATGTTGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAATGGTGGTAGCACAGGTTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGCCAGTGAGAGCCCAGACACAAACGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-21*01IGHV3-21*011IGHVGenomic and rearranged1Homo sapiensATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGAATCATGGAAAAGTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACGGTGGATGTGTGTGACAGTTTCTGACCAATGTCTCTCTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT......AGTAGTTACATATACTACGCAGACTCAGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA159454146148158234257309332447455493
IGHV3-21*06IGHV3-21*061IGHVGenomic and rearranged1Homo sapiensATGGAACTGGGGCTCCGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGAATCATGGAAAAGTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACGGTGGATGTGTGTGACAGTTTCTGACCAATGTCTCTCTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAATTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT......AGTAGTTACATATACTACGCAGACTCAGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAATTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA159454146148158234257309332447455493
IGHV3-23*01IGHV3-23*011IGHVGenomic and rearranged1Homo sapiensGAACTCACCATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCTAAAATAAAAGGTAATTCATGGAGAAATAGAAAAATTGAGTGTGAATGGATAAGAGTGAGAGAAACAGTGGATACGTGTGGCAGTTTCTGACCAGGGTTTCTTTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGAGCCCAGACACAAACCGAGGTGCAGCTGTTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGT......GGTGGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGA170465159169245268320343458466504
IGHV3-23*04IGHV3-23*041IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCTATTTTAAAAGGTAATTCATGGAGAAATAGAAAAATTGAGTGTGAATGGATAAGAGTGAGAGAAACAGTGGATACGTGTGGCAGTTTCTGACCAGGGTTTCTTTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGT......GGTGGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGA161456146150160236259311334449457495
IGHV3-23D*01IGHV3-23D*011IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCTATTTTAAAAGGTAATTCATGGAGAAATAGAAAAATTGAGTGTGAATGGATAAGAGTGAGAGAAACAGTGGATACGTGTGGCAGTTTCTGACCAGGGTTTCTTTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGAGCCCAGACACAAACCGAGGTGCAGCTGTTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATTAGTGGTAGT......GGTGGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGA161456146150160236259311334449457495
IGHV3-25*02IGHV3-25*021IGHVGenomic Only1Homo sapiensATGGAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAACGTGATCTATAGAGAACTAGAGATATTGAGTATGAATGGATATGAGTGAGAAACAGTGGATACGTGTGGCAGTTTCTGACCGGGGTGTCTCTGTGTTTGCAGGTATCCAGTGTGAGATGCAGCTGGTGGAGTCTGGGGGAGGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTCAGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTTGACAAGTTAATCCTAATGGGGGTAGCACATACCTCATAGACTCCGGTAAGGACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTCTATTAGTGTACCAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGATGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTC............AGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTTGACAAGTTAATCCTAAT......GGGGGTAGCACATACCTCATAGACTCCGGTAAG...GACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTCTATTAGTGTACCAGAGA159454146148158234257309332447455493
IGHV3-25*04IGHV3-25*041IGHVGenomic and rearranged1Homo sapiensTCGCGAGTTGTTTGCAGGTGTCCAGTGTGAGACGCAGCTGGTGGAGTCTGGGGGAGGCTTGGCAAAGCCTGGGCGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTCAGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAATGGGGGTAGCACATACCTCATAGACTCCGGTAAGGACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTGTATTACTGTACCAGAGACACAGTGAGGGGAGGTCATTGGAGACGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGCAAAGCCTGGGCGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTC............AGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAAT......GGGGGTAGCACATACCTCATAGACTCCGGTAAG...GACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTGTATTACTGTACCAGAGA293241828104127179202317325353
IGHV3-30-3*01IGHV3-30-3*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGCAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGCAATAAATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA159454146148158234257309332447455493
IGHV3-30-3*03IGHV3-30-3*031IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA159454146148158234257309332447455493
IGHV3-30-5*01IGHV3-30-5*011IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGA159454146148158234257309332447455493
IGHV3-30-5*02IGHV3-30-5*021IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCACGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCAGTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATACGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATACGGTATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGA159454146148158234257309332447455493
IGHV3-30*01IGHV3-30*011IGHVGenomic and rearranged1Homo sapiensGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCACTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTAGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTAGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA111406100110186209261284399407429
IGHV3-30*02IGHV3-30*021IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCACGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCAGTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATACGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATACGGTATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGA159454146148158234257309332447455493
IGHV3-30*03IGHV3-30*031IGHVGenomic Only1Homo sapiensGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA168463157167243266318341456464502
IGHV3-30*04IGHV3-30*041IGHVGenomic and rearranged1Homo sapiensGCCCTCCCTCTACTGATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGACGAGCCCAGCACTGGAAGTCGCCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA281576270280356379431454569577615
IGHV3-30*18IGHV3-30*181IGHVGenomic and rearranged1Homo sapiensGCCCTCCCTCTACTGATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATCATATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGA281576270280356379431454569577615
IGHV3-33*01IGHV3-33*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTCGTTGCTCTTTTAAGAGGTGATTCATGGAGAAATAGAGAGACTGAGTGTGAGTGAACATGAGTGAGAAAAACTGGATTTGTGTGGCATTTTCTGATAACGGTGTCCTTCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCATTGTGCGCCCAGACACAAACCCAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA159454146148158234257309332447455493
IGHV3-35*01IGHV3-35*011IGHVGenomic and rearranged1Homo sapiensAAATAGGAGACATNCAAATAGGCCCCCCCCTTTCCTGATAAAAAGCAGCCCAGTCCTGACCCTGCAGCCCTGGGAGAGAAGCACCAGCCCTGGGATTCTCAGGTGTTTCCACTTTGTCATCAGCAACAAACAAATTACCATGGAATTTGGCCTGAGCTGGGTTTTCCTTGCTGCTATTTTAAAAGGTGATTCATGAAGAACTAAGGATATTGAGTGAGTGGACATGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGCAGACTCTGTGAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCGAGGACACGGCTGTGTATTACTGTGTGAGAAACACTGTGAGAGGTCGGAAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGCAGACTCTGTGAAG...GGCCGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCGAGGACACGGCTGTGTATTACTGTGTGAGAAA298593287297373396448471586594632
IGHV3-38-3*01IGHV3-38-3*011IGHVGenomic and rearranged1Homo sapiensATGCAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGATGATTCATGGAGAACTACAGATGTTGAGTGTGAGTGGACATGAGTGAGCAAAACAGTGGGTATGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTCGGGGAGTCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAATGAGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGTCTGGAGTGGGTCTCATCCATTAGTGGTGGTAGCACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGCATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTAAGAAAGACACAGTGAGGGGAGGTCATTGTGTGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTCGGGGA...GTCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAATGAGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGTCTGGAGTGGGTCTCATCCATTAGTGGT............GGTAGCACATACTACGCAGACTCCAGGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGCATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTAAGAAAGA161450148150160236259311328443451489
IGHV3-38*01IGHV3-38*011IGHVGenomic and rearranged1Homo sapiensCAACTCATCATGCAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGGTATTTTAAAAGGTGATTCATGGAGAACTACAGATGTTGAGTGTGAGTGGACATGAGTGAGCCAAACAGTGGGTTTGTGTGGCAGTTTCTGACCTGGTGTCTCTGTGTTTACAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTGGTGGTAGCACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGCGTATTACTGTGCCAGATATACACAGAGGGGAAGTCATTGTGCGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTGGT............GGTAGCACATACTACGCAGACTCCAGGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGCGTATTACTGTGCCAGATATA169460158168244267319336451452490
IGHV3-38*02IGHV3-38*021IGHVGenomic Only1Homo sapiensATGCAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGGTATTTTAAAAGGTGATTCATGGAGAACTACAGATGTTGAGTGTGAGTGGACATGAGTGAGCAAAACAGTGGGTTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTGGTGGTAGCACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGTGTATTACTGTGCCAGATATACACAGAGGGGAAGTCATTGTGCGCCCAGACACAAACCTCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTGGT............GGTAGCACATACTACGCAGACTCCAGGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGTGTATTACTGTGCCAGATATA161452146150160236259311328443453491
IGHV3-38*03IGHV3-38*031IGHVGenomic Only1Homo sapiensATGCAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGGTATTTTAAAAGGTGATTCATGGAGAACTACAGATGTTGAGTGTGAGTGGACATGAGTGAGCAAAACAGTGGGTTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGTCTGGAGTGGGTCTCATCCATTAGTGGTGGTAGCACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGTGTATTACTGTGCCAGATATACACAGAGGGGAAGTCATTGTGCGCCCAGACACAAACCTCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGTCTGGAGTGGGTCTCATCCATTAGTGGT............GGTAGCACATACTACGCAGACTCCAGGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCACGGCCGTGTATTACTGTGCCAGATATA161452146150160236259311328443453491
IGHV3-42D*01IGHV3-42D*011IGHVGenomic Only1Homo sapiensAAGTCCAAATGGTCTATTTTGTTTTTTATTCTGTTTACTTTTAAAGTTGTAGTCATGAATTCTTTGCCTAGGACAATCTCCAGAACAATATTTCCTAGAATAGCATCTGCAACTTTCAGACTCTCAGGTCTCCCAGTTAAGTCTTTTATCCATATTGGCTTAATTTTGGATATAGTGAGAGATACGGGTCCAGTTTTATTCTGCTGCAAATGGCTGTTCAGTTTTTCCTGCACAATTTATTTAACAAGGTGACCTGTTCCCAGTGTATGCTTTTTGTCTAGTTTTTCACAGTCAGTTTGGCTGCAGGCATTTGACTTTATTTATGAAATATCTATTCTGTTCCACTCATCTATGGCTTTCTGCTAGATTGTTACTTGTGTATAATAATACTACTGGTTTTTGTATGCTTTTTTCATTTATTCTAAAACTTTACTGAATTAACTCATCAATTCTAGGAGTATTTTGAAAGAATATTAGTTTTTTTTAAGTACAAAATCATATTATCAGCAAACACAAAGAGTTTGACTTCCTCTTTTCCAATTCGAGTCCCTTTCTTTCTTTCTCTTGCCTAATTTCTCTGGCTAGGATTTCAAGTTCTATATTGATTAAGAGTGGTGAAAGTGGGCATCCTTGACGTGTTCTGAGTCTTAGGAGGAATACTTTCAACATATTCCTATTCAGTATAATGTTGTTTCGGAGTTTGAAGGTGATTTATGGAGAATGAGAGATGTTGAGTGCGAGTGGACATGAGTGAGAGAAACAGTGGATATGTGCGGCCGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGCGTCCAGCATGAGGCGCAGCTGGTGGAGGCTGGGGGAGGCTTGGTACAGCCTGGGTAGGTCCCTGAGACTCTCATTTGCAGCTTCTGGATTCACCTTCAGTGACTTCTGGATGCACTGGATCCGCCAGGCTTCTGGGAAAGGGCTGGAGTGGGTTGGCCGTATTAGAACCAAACGTAACAGTTACACGACGGAATGCGCTGCATCTGTGAAAGGCAGGTTCACCATCTCAAGAGATGATTCAAAGAACACACTGTATATGCAAATGAATACCCTGAAAACCAAGTACACGGCCATCTATTACTGTACTAGAGACACAGTGAGGGGAGGTTAACCTGGGCCCATACACAAATCTCCAGCATGAGGCGCAGCTGGTGGAGG...CTGGGGGAGGCTTGGTACAGCCTGGGTAGGTCCCTGAGACTCTCATTTGCAGCTTCTGGA............TTCACCTTCAGTGACTTCTGGATGCACTGGATCCGCCAGGCTTCTGGGAAAGGGCTGGAGTGGGTTGGCCGTATT......AGAACCAAACGTAACAGTTACACGACGGAATGC...GCTGCATCTGTGAAAGGCAGGTTCACCATCTCAAGAGATGATTCAAAGAACACACTGTATATGCAAATGAATACCCTGAAAACCAAGTACACGGCCATCTATTACTGTACTAGAGA8131123148802812888911963986110111241162
IGHV3-43*01IGHV3-43*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGATAAATAGAGATGTTGAGTGTGAGTGAACATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTGTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGGGAAGTCAGCGAGAGCCCAGACAAAAACCGAAGTGCAGCTGGTGGAGTCTGGGGGA...GTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGAT......GGTGGTAGCACATACTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATA161458146150160236259311334449459497
IGHV3-43*02IGHV3-43*021IGHVGenomic and rearranged1Homo sapiensTCGCGAGCTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGTCAAGCTCCAGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTGGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGGGAGGTCAGTGGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGTCAAGCTCCAGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTGGGGAT......GGTGGTAGCACATACTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAAGATA293261828104127179202317327355
IGHV3-43D*03IGHV3-43D*031IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGACTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGATAAATAGAGATGTTGAGTGTGAGTGAACATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTGTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACCTACTATGCAGACTCTGTGAAGGGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGAGAAGTCAGTGAGAGCCCAGACAAAAACCGAAGTGCAGCTGGTGGAGTCTGGGGGA...GTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGAT......GGTGGTAGCACCTACTATGCAGACTCTGTGAAG...GGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGATA161458146150160236259311334449459497
IGHV3-47*01IGHV3-47*011IGHVGenomic Only1Homo sapiensTCGCGAGGTGTTTGCAGGTGTCCAGTGTGAGGATCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGACCCTCCTGTGCAGCCTCTGGATTCGCCTTCAGTAGCTATGCTCTGCACTGGGTTCGCCGGGCTCCAGGGAAGGGTCTGGAGTGGGTATCAGCTATTGGTACTGGTGGTGATACATACTATGCAGACTCCGTGATGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAAGTCCTTGTATCTTCATATGAACAGCCTGATAGCTGAGGACATGGCTGTGTATTATTGTGCAAGAGACACAGTGAGGGGAAGTCAATGGAGGATCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGCGACCCTCCTGTGCAGCCTCTGGATTCGCCTTC............AGTAGCTATGCTCTGCACTGGGTTCGCCGGGCTCCAGGGAAGGGTCTGGAGTGGGTATCAGCTATTGGTACTGGT.........GGTGATACATACTATGCAGACTCCGTGATG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAAGTCCTTGTATCTTCATATGAACAGCCTGATAGCTGAGGACATGGCTGTGTATTATTGTGCAAGAGA293211828104127179199314322350
IGHV3-47*02IGHV3-47*021IGHVGenomic and rearranged1Homo sapiensTGTTTGCAGGTGTCCAGTGTGAGGATCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACCCTCCTGTGCAGCCTCTGGATTCGCCTTCAGTAGCTATGTTCTGCACTGGGTTCGCCGGGCTCCAGGGAAGGGTCCGGAGTGGGTATCAGCTATTGGTACTGGTGGTGATACATACTATGCAGACTCCGTGATGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAAGTCCTTGTATCTTCAAATGAACAGCCTGATAGCTGAGGACATGGCTGTGTATTATTGTGCAAGAGACACAGTGAGGGGAGGTCAATGCTCGCGAGAGGATCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACCCTCCTGTGCAGCCTCTGGATTCGCCTTC............AGTAGCTATGTTCTGCACTGGGTTCGCCGGGCTCCAGGGAAGGGTCCGGAGTGGGTATCAGCTATTGGTACTGGT.........GGTGATACATACTATGCAGACTCCGTGATG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAAGTCCTTGTATCTTCAAATGAACAGCCTGATAGCTGAGGACATGGCTGTGTATTATTGTGCAAGAGA21313102096119171191306314342
IGHV3-48*01IGHV3-48*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCAGTGTGACACCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-48*02IGHV3-48*021IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGACGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGACGAGGACACGGCTGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-48*03IGHV3-48*031IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGTTATGAAATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTGGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGTTATGAAATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......GGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-48*04IGHV3-48*041IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGTGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGAGAGATTTAGTGTGTGTGGATATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGATCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGTAGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATTAGTAGTAGT......AGTAGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-49*03IGHV3-49*031IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTTAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTAATTCATGGTGTACTAGAGATACTGAGTGTGAGGGGACATGAGTGGTAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTTTCTGTGTTTGCAGGTGTCCAATGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTTGGTGATTATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGACACAGTGAGGGGAGGTCAATGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTT............GGTGATTATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGA161462146150160236259311340455463501
IGHV3-49*04IGHV3-49*041IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTTAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTAATTCATGGTGTACTAGAGATACTGAGTGTGAGGGGACATGAGTGGTAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTTTCTGTGTTTGCAGGTGTCCAATGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTTGGTGATTATGCTATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTT............GGTGATTATGCTATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGA161462146150160236259311340455463501
IGHV3-53*01IGHV3-53*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAACTAGAGATATTGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTAACCAATGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCATTGTGCGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGAGGA...GGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA159451146148158234257309329444452490
IGHV3-53*02IGHV3-53*021IGHVGenomic and rearranged1Homo sapiensATGGAGTTTTGGCTGAGCTGGGTTTTCCTTGTTGCTATTTCAAAAGGTGATTCATGGAGAACTAGAGATATCGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTAACCAATGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGACTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGCCATTGTGCGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGACTGGAGGA...GGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA159451146148158234257309329444452490
IGHV3-53*04IGHV3-53*041IGHVGenomic and rearranged1Homo sapiensTCGCGAGTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGACACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCAATGGAGGTGCAGCTGGTGGAGTCTGGAGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGACACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA293211828104127179199314322350
IGHV3-64*01IGHV3-64*011IGHVGenomic and rearranged1Homo sapiensAGCTCTGGGAGAGGAGCCCCCCCCCTGGGATTCCCAGGTGTTTTCATTTGGTGATCAGCACTGAACACAGAAGAGTCATGACGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTTAAAGGTGATTCATGAGGAAATAGAGATATTGAGTGTGAGTGGACATGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATATTATGCAAACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGAGAAGTTAATGTGGGACCATGCAGAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATATTATGCAAACTCTGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGA241536230240316339391414529537575
IGHV3-64*02IGHV3-64*021IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTTAAAGGTGATTCATGAGGAAATAGAGATATTGAGTGTGAGTGGACATGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATATTATGCAGACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGAGAAGTTAATGTGGGACCATGCAGAAACCGAGGTGCAGCTGGTGGAGTCTGGGGAA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATATTATGCAGACTCTGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-64D*06IGHV3-64D*061IGHVGenomic and rearranged1Homo sapiensATGGAGTTCTGGCTGAGCTGGGTTCTCCTTGTTGCCATTTTAAAAGGTAATTCATGGAGAACTAGAGATAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGATGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATACTACGCAGACTCCGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGA157452146146156232255307330445453491
IGHV3-64D*08IGHV3-64D*081IGHVGenomic and rearranged1Homo sapiensATGGAGTTCTGGCTGAGCTGGGTTCTCCTTGTTGCCGTTTTAAAAGGTAATTCATGGAGAACTAGAGATAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGATGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACTCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATACTACGCAGACTCCGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACTCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGA157452146146156232255307330445453491
IGHV3-64D*09IGHV3-64D*091IGHVGenomic and rearranged1Homo sapiensATGGAGTTCTGGCTGAGCTGGGTTCTCCTTGTTGCCATTTTAAAAGGTAATTCATGGAGAACTAGAGATAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGATGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATACTACGCAGACTCAGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATACTACGCAGACTCAGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGTGAAAGA157452146146156232255307330445453491
IGHV3-66*01IGHV3-66*011IGHVGenomic and rearranged1Homo sapiensTCGCGAGGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAATGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA293211828104127179199314322350
IGHV3-66*02IGHV3-66*021IGHVGenomic and rearranged1Homo sapiensATCTGCACTGGGCCCGGCCTCTCCTCAGATGTCCCATCACAGAGCTTGCTATATAATGGGGGACATGCAAATAGGGCCCTCCCTCTGCTGATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGAGGAGCCCAGCACTGGGATTCCGAGGTGTTTCCATTCAGTGATCTGCACTGAACACAGAGGACTCGCCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAACTAGAGATATCGAGTGTGAGTGAAGATGAGTGAGAGAAACAGTGGGTATGTGTGGCAGTTTCTGACCAATGCCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGCCATTGTGCGCCCAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA356648345355431454506526641649679
IGHV3-66*03IGHV3-66*031IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAACTAGAGATATTGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTAACCAATGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTCAGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCTGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGCCATTGTGCGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGAGGA...GGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGGTTCACCGTC............AGTAGCAACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCTGT.........GGTAGCACATACTACGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGAGA159451146148158234257309329444452490
IGHV3-69-1*01IGHV3-69-1*011IGHVGenomic and rearranged1Homo sapiensCTCAATAGAACTGTTTTAAAATAAAAATTACAAAATTATAAGATTTATAGGTTTTAAGGTTTTATCACAGAGCAGATTTACCATAAGAAACCACAATTTCCCAAATGCTATCAATATCACAAATCTCCCCAGGACACTGTCACGTGCTCTGAGCCCCACTCTCTCCAAAGGCCTCTAACCAGAGAGCTTACTATATAGTAGGAGACATGGAAATAGAGCCCTCCCTCTGCTTATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGACAGGAGCCCCAGCCCTGGGATTTTCAGGTGTTTTCATTTGGTGATCAGGACTGAACACAGAGGACCACCAAGGAGTCATGGCTGAGCTGGCTTTTTCTTGTGGCTATTTTAAAAGGTAATTCATGGAGAAATAGAAAAATTGAGTGTGAGTGGATAAGAGTGAGATAAACAGTGGATTTGTGTGGAAGTTTCTGACCAGGTTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT.........AGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA500792489499575598650670785793831
IGHV3-69-1*02IGHV3-69-1*021IGHVGenomic and rearranged1Homo sapiensTCGCGAGTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACTACTACATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTACCATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGACACAGTGAGGGAGTCATGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACTACTACATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT.........AGTACCATATACTACGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTTTATTACTGTGCGAGAGA293211828104127179199314322350
IGHV3-7*01IGHV3-7*011IGHVGenomic and rearranged1Homo sapiensATGGAATTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGGAAGATTGAGTGTGTGTGGATATGAGTGTGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGAT......GGAAGTGAGAAATACTATGTGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-7*03IGHV3-7*031IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGGAAGATTGAGTGTGTGTGGATATGAGTGTGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATAAAGCAAGAT......GGAAGTGAGAAATACTATGTGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-7*05IGHV3-7*051IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAGGTGATTCATGGAAAACTAGGAAGATTGAGTGTGTGTGGATATGAGTGTGAGAAACAGTGGATTTGTGTGTCAGTTTCTGACCTTGGTGTCTCTTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAAGGGCTGGAGTGGGTGGCCAACATAAAGCAAGATGGAAGTGAGAAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGTAGCTATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAAGGGCTGGAGTGGGTGGCCAACATAAAGCAAGAT......GGAAGTGAGAAATACTATGTGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-72*01IGHV3-72*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGTTATTTTACAAGGTGATTTATGGAGAACTAGAGATGTTAAGTGTGAGTGGACGTGAGTGAGAGAAACAGTGGATTTGTGTGACAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTGACCACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTACTAGAAACAAAGCTAACAGTTACACCACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTGCTAGAGACACAGCGAGGGGAGGTCAGTGTGAGCCCGGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTGACCACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTACTAGAAACAAAGCTAACAGTTACACCACAGAATACGCCGCGTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTGCTAGAGA161462146150160236259311340455463501
IGHV3-73*01IGHV3-73*011IGHVGenomic and rearranged1Homo sapiensTGTGCACAGCCTTCTCGTCAGGCGTCCCAGCCCAGACCTTGCTATGTAGCAGAAGACATGCAAATAAGACCCCCCTTTTTGCTGATGAAAAGCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGAGGAGCTCCAGCCTTGGGATTCCCAGCTGTCTCCACTCGGTGATCGGCACTGAATACAGGAGACTCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGGGAACTAGAGATACTGAGTGTGAGTGGACATGAGTGAGAGAAACAGTGGACGTGTGTGGCACTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGGTTCACCTTCAGTGGCTCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGCCGTATTAGAAGCAAAGCTAACAGTTACGCGACAGCATATGCTGCGTCGGTGAAAGGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTACTAGACACACAGTGAGGGGAGGTCAGTGTGAGCCCGGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGGTTCACCTTC............AGTGGCTCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGCCGTATTAGAAGCAAAGCTAACAGTTACGCGACAGCATATGCTGCGTCGGTGAAA...GGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTACTAGACA353654342352428451503532647655693
IGHV3-73*02IGHV3-73*021IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGGGAACTAGAGATACTGAGTGTGAGTGGACATGAGTGAGAGAAACAGTGGACGTGTGTGGCACTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGGTTCACCTTCAGTGGCTCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGCCGTATTAGAAGCAAAGCTAACAGTTACGCGACAGCATATGCTGCGTCGGTGAAAGGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTACTAGACACACAGTGAGGGGAGGTCAGTGTGAGCCCGGACACAAACCGAGGTGCAGCTGGTGGAGTCCGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGGTTCACCTTC............AGTGGCTCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGCCGTATTAGAAGCAAAGCTAACAGTTACGCGACAGCATATGCTGCGTCGGTGAAA...GGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTACTAGACA161462146150160236259311340455463501
IGHV3-74*01IGHV3-74*011IGHVGenomic and rearranged1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGAGAACTGGAGATATGGAGTGTGAATGGACATGAGTGAGATAAGCAGTGGATGTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGATGGGAGTAGCACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAAGTCAATGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCCGGGGGA...GGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATTAATAGTGAT......GGGAGTAGCACAAGCTACGCGGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCAAGAGA161456146150160236259311334449457495
IGHV3-9*01IGHV3-9*011IGHVGenomic and rearranged1Homo sapiensCAAATAGGGCCCTCCCTCTGCTGATGAAAACCAGCCCAGCCCTGACCCTGCAGCTCTGGGAGAGGAGCCCCAGCCCTGAGATTCCCAGGTGTTTCCATTCAGTGATCAGCACTGAACACAGAGGACTCACCATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGATTCATGGAGAAATAGAGAGATTGAGTGTGAGTGGACATGAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGGGAAGTCAGCGAGAGCCCAGACAAAAACCGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAAT......AGTGGTAGCATAGGCTATGCGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGATA280577269279355378430453568578616
IGHV3-9*02IGHV3-9*021IGHVGenomic Only1Homo sapiensTTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTCTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGGAGGTCGATTGCTCGCGAGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTCT............GATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAAT......AGTGGTAGCATAGGCTATGCGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAAGATA22319112197120172195310320348
IGHV3-9*03IGHV3-9*031IGHVGenomic and rearranged1Homo sapiensATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAGGTGATTCATGGAGAAATAGAGAGATTGAGTGTGAGTGGACATGAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACATGGCCTTGTATTACTGTGCAAAAGATACACAGTGAGGGGAAGTCAGCGAGAGCCCAGACAAAAACCGAAGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAAT......AGTGGTAGCATAGGCTATGCGGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACATGGCCTTGTATTACTGTGCAAAAGATA149446146138148224247299322437447485
IGHV3-NL1*01IGHV3-NL1*011IGHVGenomic Only1Homo sapiensCTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGGAGGGGAGGTCAATGCTCGCGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT......GGTAGTAGCACATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAAAGA22317112197120172195310318346
IGHV4-28*01IGHV4-28*011IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGAGCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGTGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAA140435146129139215241293313428436474
IGHV4-28*03IGHV4-28*031IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGGGGTATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAGA140435129139215241293313428436464
IGHV4-30-2*01IGHV4-30-2*011IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGAGCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGCTGCAGCTGCAGGAGTCCGGCTCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAGGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGCTGCAGCTGCAGGAGTCCGGCTCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAGGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGA140438146129139215244296316431439477
IGHV4-30-2*06IGHV4-30-2*061IGHVGenomic Only1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGAGCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGCTGCAGCTGCAGGAGTCCGGCTCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGTCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAGGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGCTGCAGCTGCAGGAGTCCGGCTCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGTCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAGGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGA140438146129139215244296316431439477
IGHV4-30-4*01IGHV4-30-4*011IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGTGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGATTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTGATTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGA140438146129139215244296316431439477
IGHV4-30-4*07IGHV4-30-4*071IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGTGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCCAGAGA140438146129139215244296316431439477
IGHV4-31*01IGHV4-31*011IGHVGenomic and rearranged1Homo sapiensTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCTAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCTAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA273251626102131183203318326348
IGHV4-31*03IGHV4-31*031IGHVGenomic and rearranged1Homo sapiensATGAAACATCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGTGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA140438146129139215244296316431439477
IGHV4-34*01IGHV4-34*011IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGAATGCGGATATGAAGATATGAGATGCTGCCTCTGATCCCAGGGCTCACTGTGGGTTTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTACAGCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCTATGGTGGGTCCTTCAGTGGTTACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCAATCATAGTGGAAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGGCACAGTGAGGGGAGGTGAGTGTGAGCCCAGACAAAAACCCAGGTGCAGCTACAGCAGTGGGGCGCA...GGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCTATGGTGGGTCCTTC............AGTGGTTACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCAATCATAGT.........GGAAGCACCAACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGAGG141433146130140216239291311426434472
IGHV4-38-2*01IGHV4-38-2*011IGHVGenomic and rearranged1Homo sapiensGGCGCCTCTCTCATCCCTTTTCACTGCTCCGTACAAAGGCACCACCCACATGCAAATCCTCACTTAGGCGCCCACAGGAAGCCACAACACATTTCCTTAAATTCAGGTCCAACTCATAAGGGAAATGCTTTCTGAGAGTCATGGACCTCCTGTGCAAGAACATGAAGCACCTGTGGTTTTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGGATCCAGACGTGAAGATATGGGAAGTGCCTCTGATCCCAGGGCTCACCGTGGGTTTTTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTGGTTACTACTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTGGTTACTACTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATCATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGA301596290300376402454474589597625
IGHV4-38-2*02IGHV4-38-2*021IGHVGenomic and rearranged1Homo sapiensATGAAGCACCTGTGGTTTTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGGATCCAGACGTGAAGATATGGGAAGTGCCTCTGATCCCAGGGCTCACCGTGGGTTTTTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTTACTCCATCAGCAGTGGTTACTACTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTTACTCCATCAGC.........AGTGGTTACTACTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATCATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGA140435146129139215241293313428436474
IGHV4-39*01IGHV4-39*011IGHVGenomic and rearranged1Homo sapiensATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGTGAGTGTTTCTAGGATGCAGACATGGAGATATGGGAGGCTGCCTCTGATCCCAGGGCTCACTGTGGGTTTTTCTGTTCACAGGGGTCCTGTCCCAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGACACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACAAAAACCCAGCTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGACA141439146130140216245297317432440478
IGHV4-39*07IGHV4-39*071IGHVGenomic and rearranged1Homo sapiensATGAAGCACCTGTGGTTCTTCCTCCTGCTGGTGGCGGCTCCCAGATGTGAGTGTTTCTAGGATGCAGACATGGAGATATGGGAGGCTGCCTCTGATCCCAGGGCTCACTGTGGGTTTTTCTGTTCACAGGGGTCCTGTCCCAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACAAAAACCCAGCTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA141439146130140216245297317432440478
IGHV4-4*02IGHV4-4*021IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGGGGTATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC.........AGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGT.........GGGAGCACCAACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA140435146129139215241293313428436474
IGHV4-4*07IGHV4-4*071IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGGGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA140432146129139215238290310425433471
IGHV4-4*08IGHV4-4*081IGHVGenomic Only1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGGGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATACCAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGA140432146129139215238290310425433471
IGHV4-59*01IGHV4-59*011IGHVGenomic and rearranged1Homo sapiensATGAAACATCTGTGGTTCTTCCTTCTCCTGGTGGCAGCTCCCAGATGTGAGTATCTCAGGGATCCAGACATGGGGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACAAAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGA140432146129139215238290310425433471
IGHV4-NL1*01IGHV4-59*081IGHV4-59*08IGHVGenomic and rearranged1Homo sapiensTTGCGAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGACACACAGTGAGGGGAGGTGAGTGTGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATC............AGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGACA473393646122145197217332340368
IGHV4-61*01IGHV4-61*011IGHVGenomic and rearranged1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGGATCCAGACATGGGGGTATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGC......AGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAGA140438146129139215244296316431439477
IGHV4-61*02IGHV4-61*021IGHVGenomic and rearranged1Homo sapiensATGAAACATCTGTGGTTCTTCCTCCTCCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAGGGATCCAGACATGGGGATATGGGACGTGCCTCTGAGCCTAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACAAAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGT.........GGGAGCACCAACTACAACCCCTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAGA140438146129139215244296316431439477
IGHV5-10-1*01IGHV5-10-1*011IGHVGenomic and rearranged1Homo sapiensATGGGGTCAACCGCCATCCTTGGCCTCCTCCTGGCTGTTCTCCAAGGTCAGTCCTGCCGAGGGCTTGAGGTCACAGAGGAGAACGGGTGGAAAGCAACTCCTGATTCAAATTTTGTGTCTTCCATACAGGAGTCTGTGCCGAAGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAGGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCAGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGAGGATTGATCCTAGTGACTCTTATACCAACTACAGCCCGTCCTTCCAAGGCCACGTCACCATCTCAGCTGACAAGTCCATCAGCACTGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACACACAGTGAGAGAAACCAGCACTGAGCCCGTCTAAAACCGAAGTGCAGCTGGTGCAGTCTGGAGCA...GAGGTGAAAAAGCCCGGGGAGTCTCTGAGGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCAGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGAGGATTGATCCTAGT......GACTCTTATACCAACTACAGCCCGTCCTTCCAA...GGCCACGTCACCATCTCAGCTGACAAGTCCATCAGCACTGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACA141436146130140216239291314429437474
IGHV5-10-1*03IGHV5-10-1*031IGHVGenomic and rearranged1Homo sapiensATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAGGTCAGTCCTGCCGAGGGCTTGAGGTCACAGAGGAGAACGGGTGGAAAGCAACTCCTGATTCAAATTTTGTGTCTTCCATACAGGAGTCTGTGCCGAAGTGCAGCTGGTGCAGTCCGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAGGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCAGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGAGGATTGATCCTAGTGACTCTTATACCAACTACAGCCCGTCCTTCCAAGGCCACGTCACCATCTCAGCTGACAAGTCCATCAGCACTGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACACACAGTGAGAGAAACCAGCACTGAGCCCGTCTAAAACCGAAGTGCAGCTGGTGCAGTCCGGAGCA...GAGGTGAAAAAGCCCGGGGAGTCTCTGAGGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCAGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGAGGATTGATCCTAGT......GACTCTTATACCAACTACAGCCCGTCCTTCCAA...GGCCACGTCACCATCTCAGCTGACAAGTCCATCAGCACTGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACA141436146130140216239291314429437474
IGHV5-51*03IGHV5-51*031IGHVGenomic and rearranged1Homo sapiensAGGCCAGCCTTTTTCTGCATTTGAGGTTCTGGGTTATAAACGCTGTAGACTCCTCCCTTCAGGGCAGGGTGACAACTATGCAAATGCAAGTGGGGGCCTCCCCACTTAAACCCAGGGCTCCCCTCCACAGTGAGTCTCCCTCACTGCCCAGCTGGGATCTCAGGGCTTCATTTTCTGTCCTCCACCATCATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAGGTCAGTCCTGCCGAGGGCTTGAGGTCACAGAGGAGAACGGGTGGAAAGGAGCCCCTGATTCAAATTTTGTGTCTCCCCCACAGGAGTCTGTGCCGAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCGGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACACACAGTGAGAGAAACCAGCCCCGAGCCCGTCTAAAACCGAGGTGCAGCTGGTGCAGTCTGGAGCA...GAGGTGAAAAAGCCGGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGT......GACTCTGATACCAGATACAGCCCGTCCTTCCAA...GGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACA330625319329405428480503618626663
IGHV6-1*01IGHV6-1*011IGHVGenomic and rearranged1Homo sapiensATGTCTGTCTCCTTCCTCATCTTCCTGCCCGTGCTGGGCCTCCCATGGGGTCAGTGTCAGGGAGATGCCGTATTCACAGCAGCATTCACAGACTGAGGGGTGTTTCACTTTGCTGTTTCCTTTTGTCTCCAGGTGTCCTGTCACAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCCAGGTACAGCTGCAGCAGTCAGGTCCA...GGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCTCCGGGGACAGTGTCTCT......AGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCC...AAGTGGTATAATGATTATGCAGTATCTGTGAAA...AGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAAGAGA144448149133143219248300326441449487
IGHV7-4-1*01IGHV7-4-1*011IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCAACAGGTAAGGGGCTCCCCAGTCACTGGGCTGAGGGAGAAACCAGCACAGTCAAGTGAGACTTCATGCACTCCCATCTCCTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAATCTGGGTCTGAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAACACTGGGAACCCAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCACGGCATATCTGCAGATCTGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGACACAGTGTGGAAACCCACATCCTGAGAGTGTCAAAAACCCAGGTGCAGCTGGTGCAATCTGGGTCT...GAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAAC......ACTGGGAACCCAACGTATGCCCAGGGCTTCACA...GGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCACGGCATATCTGCAGATCTGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGA142437146131141217240292315430438476
IGHV7-4-1*02IGHV7-4-1*021IGHVGenomic and rearranged1Homo sapiensGATCCTCTTCTTGGTGGCAGCAGCAACAGGTAAGGGGCTCCCCAGTCACTGGGCTGAGGGAGAAACCAGCACAGTCAAGTGAGACTTCATGCACTCCCATCTCCTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAATCTGGGTCTGAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAACACTGGGAACCCAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCACGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGACACAGTGTGGAAACCCACCAGGTGCAGCTGGTGCAATCTGGGTCT...GAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAAC......ACTGGGAACCCAACGTATGCCCAGGGCTTCACA...GGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCACGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGA125420114124200223275298413421449
IGHV7-4-1*04IGHV7-4-1*041IGHVGenomic Only1Homo sapiensTCGCGAGTCTCCACAGGTGCCACTCCCAGGTGCAGCTGGTGCAATCTGGGTCTGAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAACACTGGGAACCCAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCATGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTCAGGTGCAGCTGGTGCAATCTGGGTCT...GAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAAC......ACTGGGAACCCAACGTATGCCCAGGGCTTCACA...GGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCATGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTATTACTGTGCGAGAGA273221726102125177200315323351
IGHV7-4-1*05IGHV7-4-1*051IGHVGenomic Only1Homo sapiensTCTCCACAGGTGCCCACTCCCAGGTGCAGCTGGTGCAATCTGGGTCTGAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTCACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAACACTGGGAACCCAACGTATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCATGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTGTTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTCTCGCGACAGGTGCAGCTGGTGCAATCTGGGTCT...GAGTTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTTCTGGATACACCTTC............ACTAGCTATGCTATGAATTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACACCAAC......ACTGGGAACCCAACGTATGCCCAGGGCTTCACA...GGACGGTTTGTCTTCTCCTTGGACACCTCTGTCAGCATGGCATATCTGCAGATCAGCAGCCTAAAGGCTGAGGACACTGCCGTGTGTTACTGTGCGAGAGA21316102096119171194309317346
IGHV7-81*01IGHV7-81*011IGHVGenomic and rearranged1Homo sapiensATGGACTGGACCTGGAGCATCCTCTTCTTGGTGGCAGCAGCAACAGGTAAGGGGCTCCCCAGTCTCGGGGTTGAGGCAGAAACCAGGCCACTCAAGTGAGGCTTTACCCACCCCTGTGTCCTCTCCACAGGTACCTACTCCCAGGTGCAGCTGGTGCAGTCTGGCCATGAGGTGAAGCAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACAGTTTCACCACCTATGGTATGAATTGGGTGCCACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGTTCAACACCTACACTGGGAACCCAACATATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGCAGATCAGCAGCCTAAAGGCTGAGGACATGGCCATGTATTACTGTGCGAGATACACCATGTGGAAACCCACATCCTGAGAGTGTCAGAAATCCAGGTGCAGCTGGTGCAGTCTGGCCAT...GAGGTGAAGCAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACAGTTTC............ACCACCTATGGTATGAATTGGGTGCCACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGTTCAACACCTAC......ACTGGGAACCCAACATATGCCCAGGGCTTCACA...GGACGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGCAGATCAGCAGCCTAAAGGCTGAGGACATGGCCATGTATTACTGTGCGAGATA142437146131141217240292315430438476
IGKV1D-8*04IGKV1D-8*042IGKV1D-8*i01IGKVRearranged Only1Homo sapiensGTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCATCATCAGTTGTCGGATGAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGTTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCCTCCGTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCATCATCAGTTGTCGGATGAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGTTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCC...12847996148156265
IGKJ1*01IGKJ1*011IGKJGenomic and rearranged1Homo sapiensGGTTTCTGTTCAGCAAGACAATGGAGAGCTCTCACTGTGGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAAC40771391
IGKJ2*01IGKJ2*011IGKJGenomic and rearranged1Homo sapiensAGTTTTTGTATAGGAGGGAAGTTAAGAGGAACCATTGTGTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAACTGTACACTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC40781392
IGKJ2*03IGKJ2*031IGKJGenomic and rearranged1Homo sapiensAGTTTTTGTATAGGAGGGAAGTTAACAGGAACCATTGTGTGTACAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAACTGTACAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC40781392
IGKJ3*01IGKJ3*011IGKJGenomic and rearranged1Homo sapiensGGTTTTTGTAAAGGGAAAAGTTAAGACGAATCACTGTGATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAACATTCACTTTCGGCCCTGGGACCAAAGTGGATATCAAAC39761381
IGKJ4*01IGKJ4*011IGKJGenomic and rearranged1Homo sapiensGGTTTTTGTTGAGGGGAAAGGGTGAGATCCCTCACTGTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAACGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAAC40771391
IGKJ5*01IGKJ5*011IGKJGenomic and rearranged1Homo sapiensGATTTTTGTTAAGGGGAAAGTAATTAAGTTAACACTGTGGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAACGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAAC40771391
IGKV1-12*01IGKV1-12*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGAAAGGAGAACACTAGGATTATACTCGGTCAGTGTGCTGAGTACTGCTTTACTATTCAGGGAACTTCTCTTACAGCATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTTCCAGATGCGACATCCAGATGACCCAGTCTCCATCTTCCGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCCCACAGTGTTACCAACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCTTCCGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCC185471149174184263280332340449472499
IGKV1-13*01IGKV1-13*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTTCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGCAGTTTACTCAGCCCAGGGGGCTCAGTACAGCCTGGCTATTCAGGGAAATTCTCTTACTACATGATTAATTGTGTGGACCATTTGTGTTTATGCTTCCAATCTCAGGTGCCAGATGTGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATTAGCAGTGCTTTAGCCTGATATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATGATGCCTCCAGTTTGGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTTTAATAATTACCCTCACATAGTGTTACAAACCCGAACATAAACCGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATT..................AGCAGTGCTTTAGCCTGATATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATGATGCC.....................TCCAGTTTGGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTTTAATAATTACCCTCA187473149176186265282334342451474501
IGKV1-16*02IGKV1-16*021IGKVGenomic and rearranged1Homo sapiensATGAGAGTCCTCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGTTTCCCAGGTAAGGATGGAGAACACTAGCAGTTTACTCAGCCCAGGGTGCTCAGTACTGCTTTACTATTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGCATTAGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGCCCCTAAGTCCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAAGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCCCACAGTGTTACACACCCAAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGCATT..................AGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGCCCCTAAGTCCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAAGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-17*01IGKV1-17*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGGATGGAGAACACTAGCAGTTTACTCAGCCCAGAGTGCTCAGTACTGCTTTACTGTTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGGTGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATTAGAAATGATTTAGGCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCGCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATT..................AGAAATGATTTAGGCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCGCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-17*03IGKV1-17*031IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGGATGGAGAACACTAGCAGTTTACTCAGCCCAGAGTGCTCAGTACTGCTTTACTGTTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGGTGTGACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGCATTAGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCGCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGCATT..................AGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCGCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-27*01IGKV1-27*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCTGCTCAGCTCCTGGGACTCCTGCTGCTCTGGCTCCCAGGTAAGGAGGGAAACAACAAAAATTTTATTCAGCCAGTGTAGCCACTAATGCCTGGCACTTCAGGAAATTCTTCTTAGAACATTACTAATCATGTGGATATGTGTTTTTATGTTCCTAATATCAGATACCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATTAGCAATTATTTAGCCTGGTATCAGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAATCAGGGGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCTCCCACTGTGATACAAGCCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATT..................AGCAATTATTTAGCCTGGTATCAGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAATCAGGGGTCCCA...TCTCGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCTCC185471149174184263280332340449472499
IGKV1-27*02IGKV1-27*021IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCTGCTCAGCTCCTGGGACTCCTGCTGCTCTGGCTCCCAGGTAAGGAGGGAAACAACAAAAATTTTATTCAGCCAGTGTAGCCACTAATGCCTGGCACTTCAGGAAATTCTTCTTAGAACATTACTAATCATGTGGATATGTGTTTTTATGTTCCTAATATCAGATACCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATTAGCAATTATTTAGCCTGGTATCAGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAATCAGGGGTCCCATCTCGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCTCCCACTGTGATACAAGCCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATT..................AGCAATTATTTAGCCTGGTATCAGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAATCAGGGGTCCCA...TCTCGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATGTTGCAACTTATTACTGTCAAAAGTATAACAGTGCCCCTCC185471149174184263280332340449472499
IGKV1-33*01IGKV1-33*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCTCAGGTAAGGAAGGATAACACTAGGAATTTTCTCAGCCAGTGTGCTCAGTACAGCCTGGCTCTTGATGGAAGCCTTCCTATAATATGACTAATAGTATGAATATTTGTGTTTATGTTTCTAATCGCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCAGGCGAGTCAGGACATTAGCAACTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTACGATGCATCCAATTTGGAAACAGGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCCACAGTGTAACAAGTCATAACATAAATCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCAGGCGAGTCAGGACATT..................AGCAACTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTACGATGCA.....................TCCAATTTGGAAACAGGGGTCCCA...TCAAGGTTCAGTGGAAGTGGA......TCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCC185471149174184263280332340449472499
IGKV1-39*01IGKV1-39*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTAAGGATGGAGAACACTAGGAATTTACTCAGCCAGTGTGCTCAGTACTGACTGGAACTTCAGGGAAGTTCTCTGATAACATGATTAATAGTAAGAATATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCCCACAGTGTTACAAGTCATAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATT..................AGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCC185471149174184263280332340449472499
IGKV1-5*01IGKV1-5*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTCAGTACTGCCTGGTTATTCAGGGAAGTCTTCCTATAATATGATCAATAGTATGAATATTTGTGTTTCTATTTCCAATCTCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATTAGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGATGCCTCCAGTTTGGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATT..................AGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGATGCC.....................TCCAGTTTGGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCC186472149175185264281333341450473500
IGKV1-5*03IGKV1-5*031IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTCAGTACTGCCTGGTTATTCAGGGAAGTCTTCCTATAATATGATCAATAGTATGAATATTTGTGTTTCTATTTCCAATCTCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATTAGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCGTCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATT..................AGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCG.....................TCTAGTTTAGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCC186472149175185264281333341450473500
IGKV1-5*04IGKV1-5*041IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTCAGTACTGCCTGGTTATTCAGGGAAGTCTTCCTATAATATGATCAATAGTATGAATATTTGTGTTTCTATTTCCAATCTCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATTAGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCATCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATT..................AGTAGCTGGTTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCA.....................TCTAGTTTAGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCC186472149175185264281333341450473500
IGKV1-5*05IGKV1-5*051IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTCAGTACTGCCTGGTTATTCAGGGAAGTCTTCCTATAATATGATCAATAGTATGAATATTTGTGTTTCTATTTCCAATCTCAGGTGCCAAATGTGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATTAGTAGCTGGCTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCATCTAGTTTAGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCCCACAGTGTTACACACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGAGTATT..................AGTAGCTGGCTGGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAAGGCA.....................TCTAGTTTAGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTGATGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTATTCTCC186472149175185264281333341450473500
IGKV1-6*01IGKV1-6*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGATGGAGAACACTGGCAGTTTACTCAGCCCAGGGTGCTCAGCACAGCCTGGCTATTCAGGGAAATTCTCTTACTACATGATTAATTGTGTGGACCATTTGTTTTTGTGTTTCCAATCTCAGGTGCCAGATGTGCCATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATTAGAAATGATTTAGGCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTACAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGCACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCCCACAGTGTTACACACCCGAACAGAAACCGCCATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATT..................AGAAATGATTTAGGCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCAGTTTACAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGCACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAAGATTACAATTACCCTCC187473149176186265282334342451474501
IGKV1-8*01IGKV1-8*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTTGGTACAGCCTGGCCCTTCAGGGAAGTTCTCTTACAACATGATTAATTGTATGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGCCATCCGGATGACCCAGTCTCCATCCTCATTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCCCACAGTGTTACACACCCAAACAAAAACCGCCATCCGGATGACCCAGTCTCCATCCTCATTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-8*02IGKV1-8*021IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTTGGTACAGCCTGGCCCTTCAGGGAAGTTCTCTTACAACATGATTAATTGTATGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGCCATCCGGATAACCCAGTCTCCATCCTCACTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCCCACAGTGTTACACACCCAAACAAAAACCGCCATCCGGATAACCCAGTCTCCATCCTCACTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-8*03IGKV1-8*031IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGCTTGGTACAGCCTGGCCCTTCAGGGAAGTTCTCTTACAACATGATTAATTGTATGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGCCATCCGGATGACCCAGTCTCCATCCTCACTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCCCACAGTGTTACACACCCAAACAAAAACCGCCATCCGGATGACCCAGTCTCCATCCTCACTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-9*01IGKV1-9*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGTTCCGTACAGCCTGGCTCTTGAGGGAAGTTCTCTTACAACATGATTAATTCTATGGACATTTGTGTTTATATTTCCAATCTCAGGTGCCAGATGTGACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGCTTAATAGTTACCCTCCCACAGTGTTACAAACCTGAACATAAACCGACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCCAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGCTTAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-9*02IGKV1-9*021IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCCAGTGTGTTCCGTACAGCCTGGCTCTTGAGGGAAGTTCTCTTACAACATGATTAATTCTATGGACATTTGTGTTTATATTTCCAATCTCAGGTGCCAGATGTGACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCTGGGCCAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGCTTAATAGTTACCCTCCCACAGTGTTACAAACCTGAACATAAACCGACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCTGGGCCAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGCTTAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1-NL1*01IGKV1-NL1*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGATGGAGAACACTAGGAATTTACTCAGCCAGTGTGCTCAGTACTGTCTGCCTATTTAGGGAAGTTACCTTACTACATGATTAATTGTGTAGACATTTGTTTTTATGTTTCCAATCTCAGGTACCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATTAGCAATTCTTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGCTCTATGCTGCATCCAGATTGGAAAGTGGGGTCCCATCCAGGTTCAGTGGCAGTGGATCTGGGACGGATTACACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTACCCCTCCCACAGTGTTACACACCCGAACAAAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCGAGTCAGGGCATT..................AGCAATTCTTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGCTCTATGCTGCA.....................TCCAGATTGGAAAGTGGGGTCCCA...TCCAGGTTCAGTGGCAGTGGA......TCTGGGACGGATTACACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTACCCCTCC185471149174184263280332340449472499
IGKV1D-12*01IGKV1D-12*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGAAAGGAGAACACTAGGATTATACTCGGTCAGTGTGCTGAGTACTGCTTTACTATTCAGGGAACTTCTCTTACAGCATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTTCCAGATGCGACATCCAGATGACCCAGTCTCCATCTTCTGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCCCACAGTGTTACCAACCCGAACATAAACCGACATCCAGATGACCCAGTCTCCATCTTCTGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACTATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTACTATTGTCAACAGGCTAACAGTTTCCCTCC185471149174184263280332340449472499
IGKV1D-13*02IGKV1D-13*021IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTTCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGCAGTTTACTCAGCCCAGGGGGCTCAGTACAGCCTGGCTATTCAGGGAAATTCTCTTACTACATGATTAATTGTGTGGACCATTTGTGTTTATGCTTCCAATCTCAGGTGCCAGATGTGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATTAGCAGTGCTTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATGATGCCTCCAGTTTGGAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTTTAATAGTTACCCTCACACAGTGTTACAAACCCGAACATAAACCGCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGGGCATT..................AGCAGTGCTTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATGATGCC.....................TCCAGTTTGGAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTTTAATAGTTACCCTCA187473149176186265282334342451474501
IGKV1D-16*01IGKV1D-16*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCTCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGTTTCCCAGGTAAGGATGGAGAACACTAGCAGTTTACTCAGCCCAGGGTGCTCAGTACTGCTTTACTATTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATTAGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGAGAAAGCCCCTAAGTCCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCCCACAGTGTTACACACCCAAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGTCAGGGTATT..................AGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGAGAAAGCCCCTAAGTCCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1D-16*02IGKV1D-16*021IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCTCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGTTTCCCAGGTAAGGATGGAGAACACTAGCAGTTTACTCAGCCCAGGGTGCTCAGTACTGCTTTACTATTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGGCAGGGTATTAGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGAGAAAGCCCCTAAGTCCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCCCACAGTGTTACACACCCAAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGGCAGGGTATT..................AGCAGCTGGTTAGCCTGGTATCAGCAGAAACCAGAGAAAGCCCCTAAGTCCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGCCAACAGTATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1D-17*01IGKV1D-17*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGGATGGAGAACACTAACAGTTTACTCAGCCCAGAGTGCTCAGTACTGCTTTACTGTTCAGGGAAATTCTCTTACAACATGATTAATTGTGTGGACATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTAACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGGCAGGGCATTAGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCACCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCCCACAGTGTTACACACCCGAACATAAACCAACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGTCGGGCGAGGCAGGGCATT..................AGCAATTATTTAGCCTGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCACCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCTACAGCATAATAGTTACCCTCC186472149175185264281333341450473500
IGKV1D-33*01IGKV1D-33*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCTCAGGTAAGGAAGGATAACACTATGAATTTTCTCAGCCAGTGGGCTCAGTACAGCCTGGCTCTTGATGGAAGCCTTCCTATAATATGACTAATAGTATGAATATTTGTGTTTATGTTTCTAATCGCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCAGGCGAGTCAGGACATTAGCAACTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTACGATGCATCCAATTTGGAAACAGGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCCCACAGTGTAACAAGTCATAACATAAATCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCAGGCGAGTCAGGACATT..................AGCAACTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTACGATGCA.....................TCCAATTTGGAAACAGGGGTCCCA...TCAAGGTTCAGTGGAAGTGGA......TCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAACAGTATGATAATCTCCCTCC185471149174184263280332340449472499
IGKV1D-39*01IGKV1D-39*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTACTCTGGCTCCGAGGTAAGGATGGAGAACACTAGGAATTTACTCAGCCAGTGTGCTCAGTACTGACTGGAACTTCAGGGAAGTTCTCTGATAACATGATTAATAGTAAGAATATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCCCACAGTGTTACAAGTCATAACATAAACCGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATT..................AGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGCTGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTACCCCTCC185471149174184263280332340449472499
IGKV1D-42*01IGKV1D-42*011IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTTCTTAGCCCACTGTGCTCTGGCACTTCTGGGAAGTTCTCTTATACCATGATTCATGGTGTGGATATTTGTTTTTATGTTTCCAATCTCAGGTGTCAGATTTGACATCCAGATGATCCAGTCTCCATCTTTCCTGTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTGCTGGGCAAGTGAGGGCATTAGCAGTAATTTAGCCTGGTATCTGCAGAAACCAGGGAAATCCCCTAAGCTCTTCCTCTATGATGCAAAAGATTTGCACCCTGGGGTCTCATCGAGGTTCAGTGGCAGGGGATCTGGGACGGATTTCACTCTCACCATCATCAGCCTGAAGCCTGAAGATTTTGCAGCTTATTACTGTAAACAGGACTTCAGTTACCCTCCCACAGGGTTACAAGCCTGAACATAAGCCGACATCCAGATGATCCAGTCTCCATCTTTCCTGTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTGCTGGGCAAGTGAGGGCATT..................AGCAGTAATTTAGCCTGGTATCTGCAGAAACCAGGGAAATCCCCTAAGCTCTTCCTCTATGATGCA.....................AAAGATTTGCACCCTGGGGTCTCA...TCGAGGTTCAGTGGCAGGGGA......TCTGGGACGGATTTCACTCTCACCATCATCAGCCTGAAGCCTGAAGATTTTGCAGCTTATTACTGTAAACAGGACTTCAGTTACCCTCC177463149166176255272324332441464491
IGKV1D-42*02IGKV1D-42*021IGKVGenomic Only1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTTCTTAGCCCACTGTGCTCTGGCACTTCTGGGAAGTTCTCTTATACCATGATTCATGGTGTGGATATTTGTTTTTATGTTTCCAATCTCAGGTGTCAGATTTGACATCCAGATGACCCAGTCTCCATCTTTCCTGTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTGCTGGGCAAGTGAGGGCATTAGCAGTAATTTAGCCTGGTATCTGCAGAAACCAGGGAAATCCCCTAAGCTCTTCCTCTATGATGCAAAAGATTTGCACCCTGGGGTCTCATCGAGGTTCAGTGGCAGGGGATCTGGGACGGATTTCACTCTCACCATCATCAGCCTGAAGCCTGAAGATTTTGCAGCTTATTACTGTAAACAGGACTTCAGTTACCCTCCCACAGGGTTACAAGCCTGAACATAAGCCGACATCCAGATGACCCAGTCTCCATCTTTCCTGTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTGCTGGGCAAGTGAGGGCATT..................AGCAGTAATTTAGCCTGGTATCTGCAGAAACCAGGGAAATCCCCTAAGCTCTTCCTCTATGATGCA.....................AAAGATTTGCACCCTGGGGTCTCA...TCGAGGTTCAGTGGCAGGGGA......TCTGGGACGGATTTCACTCTCACCATCATCAGCCTGAAGCCTGAAGATTTTGCAGCTTATTACTGTAAACAGGACTTCAGTTACCCTCC177463149166176255272324332441464491
IGKV1D-43*01IGKV1D-43*011IGKVGenomic and rearranged1Homo sapiensATGAGGGTGCCCGCTCAGCGCCTGGGGCTCCTGCTGCTCTGGTTCCCAGGTAAGGAAGGAGAACCCTAGCAGTTTACTCAGCCCAGTGTGTTCCGTACAGCCTGGCTCTTGAGGGAAGTTCTCTTACAACATGATTAATTGTATGGACATTTGTGTTTATATTTCCAATCTCAGGTGCCAGATGTGCCATCCGGATGACCCAGTCTCCATTCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCTGGGCCAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGCAAAAGCCCCTAAGCTCTTCATCTATTATGCATCCAGTTTGCAAAGTGGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACGGATTACACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTACCCCTCCCACAGTGTTACACACCCAAACAAAAACCGCCATCCGGATGACCCAGTCTCCATTCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCTGGGCCAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGCAAAAGCCCCTAAGCTCTTCATCTATTATGCA.....................TCCAGTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGCGGCAGTGGA......TCTGGGACGGATTACACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTACCCCTCC186472149175185264281333341450473500
IGKV1D-8*01IGKV1D-8*011IGKVGenomic and rearranged1Homo sapiensGTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCACCATCAGTTGTCGGATGAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGTTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCCTCCGTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCACCATCAGTTGTCGGATGAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGTTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCCTCC12877996148156265
IGKV1D-8*02IGKV1D-8*021IGKVGenomic and rearranged1Homo sapiensATGAGGGTCCCCGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTAAGGAAGGAGAACACTAGGAATTTACTCAGCCAATGTGCTCAGTACAGCCTGGCCCTTCAGGGAAATTCTCTTACTACATGATTAATTGTATGGATATTTGTTTTTATGTTTCCAATCTCAGGTGCCAGATGTGCCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCACCATCAGTTGTCGGATGAGTCAGGGCATTAGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCCTCCCACAGTGTTACACACCCGAACAAAAACCGCCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCACCATCAGTTGTCGGATGAGTCAGGGCATT..................AGCAGTTATTTAGCCTGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTATGCTGCA.....................TCCACTTTGCAAAGTGGGGTCCCA...TCAAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTGAAGATTTTGCAACTTATTACTGTCAACAGTATTATAGTTTCCCTCC185471149174184263280332340449472499
IGKV2-18*01IGKV2-18*011IGKVGenomic and rearranged1Homo sapiensATAAGGGTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTTTGGGTTCCTGGTAAGGACAGAAGGGAGATAAGGGAGGAGAATGGAGTGTGAGGGTGAGCTCTGGGGGTCCCACTGCCTGTCCACATGCACATCTTGACCTGCAAGAAAAGGTGTATAAAGTTTAGAACTGCAAGAGTCAGAAAGAGAAGATTCCTCACTCTTATAGTTCTAAACTTCATATCCTAGAAGGACAAAGGACTTGTGCTCTCATGAAGAGTGTCACACAGGAAGAGGATAATAGTGTAGGCGACTTCTTGAGTCTCTTTTGTGCCTTGTGAATGTTGGTTCTTTTTATGCCTGGATGTTTAGGGGTATGAACCAAAGTCACACAAAAAAATCACTTAGCATAAAGTAGATAACAGAAAGAATATCATTTCAATGGTTCCCAATATTTGTACATAACTTTGCACTTCTCTCACTATTTCAGGATCCAGTGGAGATATTGTGATGACCCAGACTCCACCCTCCCTGCCCGTCAACCCTGGAGAGCCGGCCTCCATCTCTTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGATATACCTATTTGCATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATTTATAGGGTTTCCAATCATCTTTCTGGGGTCCCAGACAGGTTTAGTGGCAGTGGGTCAGGTAGTGATTTCACACTGAAAATCAGCTGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTACACAGTTTCCTAACACAGTGGTACAACCCTGAACAGAAACCGATATTGTGATGACCCAGACTCCACCCTCCCTGCCCGTCAACCCTGGAGAGCCGGCCTCCATCTCTTGCAGGTCTAGTCAGAGCCTCCTGCATAGT...AATGGATATACCTATTTGCATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATTTATAGGGTT.....................TCCAATCATCTTTCTGGGGTCCCA...GACAGGTTTAGTGGCAGTGGG......TCAGGTAGTGATTTCACACTGAAAATCAGCTGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTACACAGTTTCCTAA478779149467477556588640648757780807
IGKV2-24*01IGKV2-24*011IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCTTGCTCAGCTTCTGGGGCTGCTAATGCTCTGGGTCCCTGGTGAGGACAGAAGAGAGATGAGGGAGGAGAATGGGGTGGGAGGGTGAACTCTGGGGGCCCCATTGCCTCCCATGTGTGTTCTGTCCTCATGTTAGATGTGTACGTCTTGTACTCCAGGATGGGGCTTGTAACTTTTATATCTGCGTGAGTAAGGCATGTGAGGTTTAGATCTGTAAGAATGAGGAAGATTCCAGAAGGAACAAAGACCAGTGCTCCGGTGAAGACTCTAACAGAGAAAGAGGGAATGGTAGAGGAAACTTCTAGCACTCAAAGCACTCTGCTGTGCTTTGAAAATATGTTTTTATTTTGAAATTATATATTACTAGGGTCTGAATCAAATTATAAAAATTGATTTAGCCTGAAATAAATAACAGAAGAAAAATTATTTTAAAATTGTGCTTAAAGTTTCTACATAACCTTGCACTTCTCTCTCATTATTTCAGGATCCAGTGGGGATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGTGATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGATTTCTAACCGGTTCTCTGGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCATGCAAGCTACACAATTTCCTCACACAGTGGTACAGCTCTGAACAAAAACCGATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGT...GATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGATT.....................TCTAACCGGTTCTCTGGGGTCCCA...GACAGATTCAGTGGCAGTGGG......GCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCATGCAAGCTACACAATTTCCTCA504805149493503582614666674783806833
IGKV2-24*02IGKV2-24*021IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCTTGCTCAGCTTCTGGGGCTGCTAATGCTCTGGGTCCCTGGTGAGGACAGAAGAGAGATGAGGGAGGAGAATGGGGTGGGAGGGTGAACTCTGGGGGCCCCATTGCCTCCCATGTGTGTTCTGTCCTCATGTTAGATGTGTACGTCTTGTACTCCAGGATGGGGCTTGTAACTTTTATATCTGCGTGAGTAAGGCATGTGAGGTTTAGATCTGTAAGAATGAGGAAGATTCCAGAAGGAACAAAGACCAGTGCTCCGGTGAAGACTCTAACAGAGAAAGAGGGAATGGTAGAGGAAACTTCTAGCACTCAAAGCACTCTGCTGTGCTTTGAAAATATGTTTTTATTTTGAAATTATATATTACTAGGGTCTGAATCAAATTATAAAAATTGATTTAGCCTGAAATAAATAACAGAAGAAAAATTATTTTAAAATTGTGCTTAAAGTTTCTACATAACCTTGCACTTCTCTCTCATTATTTCAGGATCCAGTGGGGATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGTGATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGATTTCTAACCGGTTCTCTGGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCACGCAAGCTACACAATTTCCTCACACAGTGGTACAGCTCTGAACAAAAACCGATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGT...GATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGATT.....................TCTAACCGGTTCTCTGGGGTCCCA...GACAGATTCAGTGGCAGTGGG......GCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCACGCAAGCTACACAATTTCCTCA504805149493503582614666674783806833
IGKV2-28*01IGKV2-28*011IGKVGenomic Only1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGTAAGAAAAGAAGGAGATGAGGAAGGAGAATAGGGTGGGAGGGTGAGCTCTAGGGCTCCACAGCATCCCATGATCCCATGTTTAGTCTAACCCTGTGTTAGAGGAGTATAATCTGTGCTGTAGAAAAGGGAACTTGATATTTTGCTCTGTGAATAATTAGAAGCCTCATAAGAAATATGACGTCTGGTGCTCCGATTAAGATTTTCAAAATATAAAGGTCTCTTATACTTTACAAAAATTGAATTCATTTTAGAATGTGTATTTTTATGGCATAAATCAGTATTTTTTAAAATTAAGTTTAAATAAATGACATAAGATAAATTATGAAAATTGCTCATTAGGTTTGTACATAACTTTGCAATTCATTATTTCAGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCCCACAGTGGTACAACCCCTAACAGAAACCGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGT...AATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGT.....................TCTAATCGGGCCTCCGGGGTCCCT...GACAGGTTCAGTGGCAGTGGA......TCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCC435736149424434513545597605714737764
IGKV2-29*01IGKV2-29*011IGKVGenomic Only1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGTAAGGATGGAAGGAGATGAGGGAGGAGGAGGGGGTGGGAGGCTGAGCTCTGGCGGCCCCACTGATTCCCGTGTTTATTCTAACCATGTGTTAAAGGAATATGCCCTATGCTCCAGGGAGAGGAATTCATATTTTGCCCTGATGATGATTTGAAAACTCCTAAAAGCAGTGCTCTGAATAATATCTTGAGAAATGAAAGAACTCTTGTGCCTATTTAATAAAGGGTTCATTTAAAATTTTGTTTTTATGATATGAATACAAATTTGTAAAAATAAAAGATTAGCCATAAATCAATATCATAAGGCAAATCTCAAAAGTTGTTCATTATGCTTTCACATAACCTTGCACTTCTCTCTCATAATTTCAGGATCCAGTGCGGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCTATGAAGTTTCCAGCCGGTTCTCTGGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGAATGCAAGGTATACACCTTCCTCCCACAGTGGTACAGACCAATACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGT...GATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCTATGAAGTT.....................TCCAGCCGGTTCTCTGGAGTGCCA...GATAGGTTCAGTGGCAGCGGG......TCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGAATGCAAGGTATACACCTTCCTCC428729149417427506538590598707730757
IGKV2-29*02IGKV2-29*021IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATCCCTGGTAAGGATGGAAGGAGATGAGGGAGGAGGAGGGGGTGGGAGGCTGAGCTCTGGCGGCCCCACTGATTCCCGTGTTTATTCTAACCATGTGTTAAAGGAATATGCCCTATGCTCCAGGGAGAGGAATTCATATTTTGCCCTGATGATGATTTGAAAACTCCTAAAAGCAGTGCTCTGAATAATATCTTGAGAAATGAAAGAACTCTTGTGCCTATTTAATAAAGGGTTCATTTAAAATTTTGTTTTTATGATATGAATACAAATTTGTAAAAATAAAAGATTAGCCATAAATCAATATCATAAGGCAAATCTCAAAAGTTGTTCATTATGCTTTCACATAACCTTGCACTTCTCTCTCATAATTTCAGGATCCAGTGCGGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTAATCTATGAAGTTTCCAGCCGGTTCTCTGGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTATACACCTTCCTCCCACAGTGGTACAGACCAATACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGT...GATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTAATCTATGAAGTT.....................TCCAGCCGGTTCTCTGGAGTGCCA...GATAGGTTCAGTGGCAGCGGG......TCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTATACACCTTCCTCC428729149417427506538590598707730757
IGKV2-30*01IGKV2-30*011IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGTAAGGGTAGAAGGGAGATGAGGGAGGAGAATGGCATGGAACGGTGAGTTCTGGGGCCCCACTGCCTCTAACAACAGTGATCTCTGGGGGTCTCACTACACTCCTATGTGTGTTCCTTTCCTGTATTGGACATGCACATGTTGTCCTCCAGAGTGGGGCATGTGATGATCAGATCTGTGAGAGTGAGGAAGATTCAAGCAGAAACAAGGATCTGTGCTCTGGGGAAGACTGACACAGAAAGGGGATGGTGTGGGGTCTTCTGGAGACCCCTTTGAGCCTTGGATCCCTTGAGTTCCATTTTGAAACTGTGTATTTTTGAAATATGAACAAATACATATATAGCCTGAAATAAACAACAAATCAAAATTTATGAAAATTACACATAAACTTTATACATAACCTTGCTCTTCTTTCTATTTATTTCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTTTCTAACCGGGACTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCCCACAGTGGTACAGCCCTGAACAAAAACCGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGT...GATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTT.....................TCTAACCGGGACTCTGGGGTCCCA...GACAGATTCAGCGGCAGTGGG......TCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCC487788149476486565597649657766789816
IGKV2-30*02IGKV2-30*021IGKVGenomic and rearranged1Homo sapiensGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGTGATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTTTCTAACCGGGACTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCCGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTACACAGT...GATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTT.....................TCTAACCGGGACTCTGGGGTCCCA...GACAGATTCAGCGGCAGTGGG......TCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCC130279111163171280
IGKV2-40*01IGKV2-40*011IGKVGenomic Only1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCTGGTAAGGACAGAAAGAGATGAGGGAGGACAACTGGGTGGGAGGTGAGCTCTGTGGGCTCCACAGCTTCACATGTTTATTCCAATAATGTGATAGAGGCACATGGTCTATGCTCCAGGGAATGGAATTCAGGTTTGTCTTATGAATAATCAGGATTCACCTCCAGGGAACGATGACCAGTGCTCTGATTAAGAACTTGAAAAAAAAGAGTTCCCTTGTGGCTAATAAATAATGGGTCTATTTTAGAAAGTCTACTTTTCATGATATAAATCAAAACTTTAAAAATGTAACTGTAAATTTATATCACAAGAGAAATTATGAAAGTTGCTCATAATGTATCTATATAAACTTGCACTTCTCTGTTATTATTTCAGGATCCAGTGAGGATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCTTGGATAGTGATGATGGAAACACCTATTTGGACTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATACGCTTTCCTATCGGGCCTCTGGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGAGTTTATTACTGCATGCAACGTATAGAGTTTCCTTCCACAGTGGTACAGCCCTGAACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCTTGGATAGTGATGATGGAAACACCTATTTGGACTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATACGCTT.....................TCCTATCGGGCCTCTGGAGTCCCA...GACAGGTTCAGTGGCAGTGGG......TCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGAGTTTATTACTGCATGCAACGTATAGAGTTTCCTTC432736149421431510545597605714737764
IGKV2D-18*01IGKV2D-18*011IGKVGenomic and rearranged1Homo sapiensATAAGGTTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTTTGGGTTCCTGGTAAGGACAGAAGGGAGATAAGGGAGGAGAATGGAGTGTGAGGGTGAGCTCTGGGGGCCCCACTGCCTGTCCACATGCACATCTTGACCTGCAAGAAAAGGTGTATAAAGTTTAGAACTGCAAGAGTCAGAAAGAGAAGATTCCTCACTCTTATAGTTCTAAACTTCATATCCTAGAAGGACAAAGGACTTGTGCTCTCATGAAGAGTGTCACACAGGAAGAGGATAATAGTGTAGGTGACTTCTTGAGTCTCTTTTGTGCCTTGTGAATGTTGGTTCTTTTTATGCCTGGATGTTTAGGGGTATGAACCAAAGTCACACAAAAAAATCACTTAGCATAAAGTAGATAACAGAAAGAATATCATTTCAATGGTTCCCAATATTTGTACATAACCTTGCACTTCTCTCACTACTTCAGGATCCAGTGGAGATATTGTGATGACCCAGACTCCACCCTCCCTGCCCGTCAACCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCCTGCATAGTAATGGATATACCTATTTGCATTGGTACCCGCAGAAGCCAGGGCAATCTCCACAGCTCCTGATTTATAGGGTTTCCAGTCGTTTTTCTGGGGTCCCAGACAGGTTTAGTGGCAGTGGGTCAGGCAGTGATTTCACACTGAAAATCAGCTGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTACACAGTTTCCTAACACAGTGGTACAACCCTGAACAGAAACCGATATTGTGATGACCCAGACTCCACCCTCCCTGCCCGTCAACCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCCTGCATAGT...AATGGATATACCTATTTGCATTGGTACCCGCAGAAGCCAGGGCAATCTCCACAGCTCCTGATTTATAGGGTT.....................TCCAGTCGTTTTTCTGGGGTCCCA...GACAGGTTTAGTGGCAGTGGG......TCAGGCAGTGATTTCACACTGAAAATCAGCTGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTACACAGTTTCCTAA478779149467477556588640648757780807
IGKV2D-24*01IGKV2D-24*011IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCTTGCTCAGCTTCTGGGGCTGCTAATGCTCTGGGTCCCTGGTGAGGACAGAAGAGAGATGAGGGAGGAGAATGGGGTGGGAGGGTGAACTCTGGGGGCCCCATTGCCTCCCATGTGTGTTCTGTCCTCATGTTAGATGTGTACGTCTTGTACTCCAGGATGGGGCTTGTAACTTTTATATCTGCGTGAGTAAGGCATGTGAGGTTTAGATCTGTAAGAATGAGGAAGATTCCAGAAGGAACAAAGACCAGTGCTCCGGTGAAGACTCTAACAGAGAAAGAGGGAATGGTAGAGGAAACTTCTAGCACTCAAAGCACTCTGCTGTGCTTTGAAAATATGTTTTTATTTTGAAATTATATATTACTAGGGTCTGAATCAAATTATAAAAATTGATTTAGCCTGAAATAAATAACAGAAGAAAAATTATTTTAAAATTGTGCTTAAAGTTTCTACATAACCTTGCACTTCTCTCTCATTATTTCAGGATCCAGTGGGGATATTGTGATGACCCAGACTCCACTCTCCTCGCCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTTCAGGTCTAGTCAAAGCCTCGTACACAGTGATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGGTTTCTAACCGGTTCTCTGGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCACGCAAGCTACACAATTTCCTCACACAGTGGTACAGCCCTGAACAAAAACCGATATTGTGATGACCCAGACTCCACTCTCCTCGCCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTTCAGGTCTAGTCAAAGCCTCGTACACAGT...GATGGAAACACCTACTTGAGTTGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTATAAGGTT.....................TCTAACCGGTTCTCTGGGGTCCCA...GACAGATTCAGTGGCAGTGGG......GCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCTGAGGATGTCGGGGTTTATTACTGCACGCAAGCTACACAATTTCCTCA504805149493503582614666674783806833
IGKV2D-26*03IGKV2D-26*031IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCTTGGGGCTGCTAATGCTCTGGGTCCCTGGTAAGGACAGAAGGAGATGAGGGAGGAGAATGGGGTGGGAAGGTAAGCCTGGGGACCCCACTGCCTTCCATGTGTGTTCTGCCCTGCCCATGTGTTAGATGTACAGGTCTTGTTCTCCAGGATGGGGAATGTGAGGTTTAAATCTGTGAGAGTGAGGACGATTCAAAAAGAAGCAAGGACCTGTGTGCTCTGGTGAATATCGTCACACAGAGAAAGGGAGGTGGTGTAGGTGACTTCTAGAATCCCCTTTGCAGCTTGCAAATTTGGAATATGTTTAGTGTATAAATACAAACAACAAAAAATTATATAGCCTGAAATAAAAAATGAAAATTTATGATAAATGACACATGATATTTGTACATATCCTTCCACTTCTTTCTATCTATTTTAGGATCCAGTGCAGAGATTGTGATGACCCAGACTCCACTCTCCTTGTCTATCACCCCTGGAGAGCAGGCCTCCATGTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTGATGGATACACCTATTTGTATTGGTTTCTGCAGAAAGCCAGGCCAGTCTCCACGCTCCTGATCTATGAAGTTTCCAACCGGTTCTCTGGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATTTTGGAGTTTATTACTGCATGCAAGATGCACAAGATCCTCCCACAGTGCTACAGCCCTGAGCACAAACCGAGATTGTGATGACCCAGACTCCACTCTCCTTGTCTATCACCCCTGGAGAGCAGGCCTCCATGTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGT...GATGGATACACCTATTTGTATTGGTTTCTGCAGAAAGCCAGGCCAGTCTCCACGCTCCTGATCTATGAAGTT.....................TCCAACCGGTTCTCTGGAGTGCCA...GATAGGTTCAGTGGCAGCGGG......TCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATTTTGGAGTTTATTACTGCATGCAAGATGCACAAGATCCTCC452753149441451530562614622731754781
IGKV2D-28*01IGKV2D-28*011IGKVGenomic Only1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCTCTGGTAAGAAAAGAAGGAGATGAGGAAGGAGAATAGGGTGGGAGGGTGAGCTCTAGGGCTCCACAGCATCCCATGATCCCATGTTTAGTCTAACCCTGTGTTAGAGGAGTATAATCTGTGCTGTAGAAAAGGGAACTTGATATTTTGCTCTGTGAATAATTAGAAGCCTCATAAGAAATATGACGTCTGGTGCTCCGATTAAGATTTTCAAAATATAAAGGTCTCTTATACTTTACAAAAATTGAATTCATTTTAGAATGTGTATTTTTATGGCATAAATCAGTATTTTTTAAAATTAAGTTTAAATAAATGACATAAGATAAATTATGAAAATTGCTCATTAGGTTTGTACATAACTTTGCAATTCATTATTTCAGGATCCAGTGGGGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCCCACAGTGGTACAACCCCTAACAGAAACCGATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGT...AATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGT.....................TCTAATCGGGCCTCCGGGGTCCCT...GACAGGTTCAGTGGCAGTGGA......TCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTCCTCC435736149424434513545597605714737764
IGKV2D-29*01IGKV2D-29*011IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATACCTGGTAAGGATGGAAGGAGATGAGGGAGGAGGAGGGGGTGGGAAGCTGAGCTCTGGCGGCCCCACTGATTCCCGTGTTTATTCTAACCATGTGTTAAAGGAATATGGCCTATGCTCCAGGGAGAGGAATTCATATTTTGCCCTGATGATGATTTGAAAACTCCTAAAAGCAGTGCTCTGAATAATATCTTGAGAAATGAAAGAACTCTTGTGCCTATTTAATAAAGGGTTCATTTAAAGAGTTTGTTTTTATGATATGAATACAAATTTGTAAAAATAAAAGATTAGCCATAAATCAATACCATAAGGCAAATCTCAAAAGTTGTTCATTATGCTTTCACATAACCTTGCACTTCTCTCTCATAATTTCAGGATCCAGTGCAGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGCCTCCACAGCTCCTGATCTATGAAGTTTCCAACCGGTTCTCTGGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAAGTATACAGCTTCCTCCCACAGTGGTACAGACCAATACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGT...GATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGCCTCCACAGCTCCTGATCTATGAAGTT.....................TCCAACCGGTTCTCTGGAGTGCCA...GATAGGTTCAGTGGCAGCGGG......TCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAAGTATACAGCTTCCTCC429730149418428507539591599708731758
IGKV2D-29*02IGKV2D-29*021IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGATACCTGGTAAGGATGGAAGGAGATGAGGGAGGAGGAGGGGGTGGGAAGCTGAGCTCTGGCGGCCCCACTGATTCCCGTGTTTATTCTAACCATGTGTTAAAGGAATATGGCCTATGCTCCAGGGAGAGGAATTCATATTTTGCCCTGATGATGATTTGAAAACTCCTAAAAGCAGTGCTCTGAATAATATCTTGAGAAATGAAAGAACTCTTGTGCCTATTTAATAAAGGGTTCATTTAAAGAGTTTGTTTTTATGATATGAATACAAATTTGTAAAAATAAAAGATTAGCCATAAATCAATACCATAAGGCAAATCTCAAAAGTTGTTCATTATGCTTTCACATAACCTTGCACTTCTCTCTCATAATTTCAGGATCCAGTGCAGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGTGATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCTATGAAGTTTCCAACCGGTTCTCTGGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAAGTATACAGCTTCCTCCCACAGTGGTACAGACCAATACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGCAAGTCTAGTCAGAGCCTCCTGCATAGT...GATGGAAAGACCTATTTGTATTGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCTATGAAGTT.....................TCCAACCGGTTCTCTGGAGTGCCA...GATAGGTTCAGTGGCAGCGGG......TCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAAGTATACAGCTTCCTCC429730149418428507539591599708731758
IGKV2D-30*01IGKV2D-30*011IGKVGenomic and rearranged1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGTAAGGGTAGAAGGGAGATGAGGGAGGAGAATGGCATGGAACGGTGAGTTCTGGGGCCCCACTGCCTCTAACAACAGTGATCTCTGGGGGTCTCACTACACTCCTATGTGTGTTCCTTTCCTGTATTGGACATGCACATGTTGTCCTCCAGAATGGGGCATGTGATGATCAGATCTGTGAGAGTCAGGAAGATTCAAGAAGAAACAAGGATCTGTGCTCTGGGGAAGACTGACACAGAAAGGGGATGGTGTGGGGTCTTCTGGAGACCCCTTTGAGCCTTGGATCCCTTGAGTTCCATTTTGAAACTGTATATTTTTGAAATATGAACAAATACATATATAGCCTGAGATAAACAACAAATCAAAATTTATGAAAATTACACATAAACTTTATACATAACCTTGCTCTTCTTTCTATTTATTTCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTTTCTAACTGGGACTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCCCACAGTGGTACAGCCCTGAACAAAAACCGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGT...GATGGAAACACCTACTTGAATTGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTATAAGGTT.....................TCTAACTGGGACTCTGGGGTCCCA...GACAGATTCAGCGGCAGTGGG......TCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACTGGCCTCC487788149476486565597649657766789816
IGKV2D-40*01IGKV2D-40*011IGKVGenomic Only1Homo sapiensATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCTGGTAAGGACAGAAAGAGATGAGGGAGGACAACTGGGTGGGAGGTGAGCTCTGTGGGCTCCACAGCTTCACATGTTTATTCCAATAATGTGATAGAGGCACATGGTCTATGCTCCAGGGAATGGAATTCAGGTTTGTCTTATGAATAATCAGGATTCACCTCCAGGGAACGATGACCAGTGCTCTGATTAAGAACTTGAAAAAAAAGAGTTCCCTTGTGGCTAATAAATAATGGGTCTATTTTAGAAAGTCTACTTTTCATGATATAAATCAAAACTTTAAAAATGTAACTGTAAATTTATATCACAAGAGAAATTATGAAAGTTGCTCATAATGTATCTATATAAACTTGCACTTCTCTGTTATTATTTCAGGATCCAGTGAGGATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCTTGGATAGTGATGATGGAAACACCTATTTGGACTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATACGCTTTCCTATCGGGCCTCTGGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGAGTTTATTACTGCATGCAACGTATAGAGTTTCCTTCCACAGTGGTACAGCCCTGAACAGAAACCGATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCTTGGATAGTGATGATGGAAACACCTATTTGGACTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATACGCTT.....................TCCTATCGGGCCTCTGGAGTCCCA...GACAGGTTCAGTGGCAGTGGG......TCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCTGAGGATGTTGGAGTTTATTACTGCATGCAACGTATAGAGTTTCCTTC432736149421431510545597605714737764
IGKV3-11*01IGKV3-11*011IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAACATGAGGTGGTTTTGCACATTAGTGAAAACTCTTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAAAGTATATCAACAATTTTGGCTCTACTCAAAGACAGTTGGTTTGATCTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACCGGAGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCCCACAGTGATTCCACATGAAACAAAAACCGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCA.....................TCCAACAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCCTCC230516149219229308325377385494517544
IGKV3-15*01IGKV3-15*011IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAATGTAGATCAACAATTTTGGCTCTACTTAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCCACAGTGATTCAACATGAAACAAAAACCGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTGGTATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC230516149219229308325377385494517544
IGKV3-20*01IGKV3-20*011IGKVGenomic and rearranged1Homo sapiensATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAACATGGGATGGTTTTGCATGTCAGTGAAAACCCTCTCAAGTCCTGTTACCTGGCAACTCTGCTCAGTCAATACAATAATTAAAGCTCAATATAAAGCAATAATTCTGGCTCTTCTGGGAAGACAATGGGTTTGATTTAGATTACATGGGTGACTTTTCTGTTTTATTTCCAATCTCAGATACCACCGGAGAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCCACAGTGATTCAGCTTGAAACAAAAACCGAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGC...............AGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCAGCAGGGCCACTGGCATCCCA...GACAGGTTCAGTGGCAGTGGG......TCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCC248537149237247326346398406515538565
IGKV3-7*04IGKV3-7*041IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCTCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAACATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAATGTAGATCAACAATTTTGGCTCTACTCAAAGACAGCTGGTTTGATCTAGATTACATGAGTGCATTTCTGTTTTATTTCCAATCTTGGATACCACCAGAGAAATTGTAATGACACAGTCTCCACCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAACCTGGTATCAGCAGAAACCTGGCCAGGCGCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTAGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCCCACAGTGATTCAACATGAAACAAAAACCGAAATTGTAATGACACAGTCTCCACCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGC...............AGCAGCTACTTAACCTGGTATCAGCAGAAACCTGGCCAGGCGCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTAGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCC230519151219229308328380388497520547
IGKV3D-11*01IGKV3D-11*011IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGTCTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAAAATAGATCAACAATTTTGGCTCTACTCAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACCGGAGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGGGTGTTAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGCCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCATCCCACAGTGATTCCACATGAAACAAAAACCGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGGGTGTT..................AGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCA.....................TCCAACAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......CCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCATCC230516149219229308325377385494517544
IGKV3D-11*02IGKV3D-11*021IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAAAATAGATCAACAATTTTGGCTCTACTCAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACCGGAGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGCCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCATCCCACAGTGATTCCACATGAAACAAAAACCGAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCA.....................TCCAACAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......CCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCATCC230516149219229308325377385494517544
IGKV3D-15*01IGKV3D-15*011IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAATGTAGATCAACAATTTTGGCTCTACTTAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCCACAGTGATTCAACATGAAACAAAAACCGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC230516149219229308325377385494517544
IGKV3D-15*03IGKV3D-15*031IGKVGenomic and rearranged1Homo sapiensATGGAAGCCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCTGCCACCTCTGCTCAGCAAGAAATATAATTAAAATTCAATGTAGATCAACAATTTTGGCTCTACTTAAAGACAGTGGGTTTGATTTTGATTACATGAGTGCATTTCTGTTTTATTTCCAATTTCAGATACCACTGGAGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCATCAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCATCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCCCACAGTGATTCAACATGAAACAAAAACCGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCATCAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGAGTTCACTCTCACCATCAGCATCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC230516149219229308325377385494517544
IGKV3D-20*01IGKV3D-20*011IGKVGenomic and rearranged1Homo sapiensATGGAAACCCCAGCGCAGCTTCTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAACATGGGATGGTTTTGCATGTCAGTGAAAACCCTCTCAAGTCCTGTTACCTGGCAACTCTGCTGAATCAATACAATAATTAAAGCTCAATATAAAGCAATAATTCTGGCTCTTCTGGGAAGACAGTGGGTTTGATTTAGATTACATGGGTGACTTTTCTATTTTATTTCCAATCTCAGATACCACCGGAGAAATTGTGTTGACGCAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCGGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCTGGCGCCCAGGCTCCTCATCTATGATGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCCCACAGTGATTCAGCTTGAAACAAAAACCGAAATTGTGTTGACGCAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCGGGGCCAGTCAGAGTGTTAGC...............AGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCTGGCGCCCAGGCTCCTCATCTATGATGCA.....................TCCAGCAGGGCCACTGGCATCCCA...GACAGGTTCAGTGGCAGTGGG......TCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCACCTCC248537149237247326346398406515538565
IGKV3D-7*01IGKV3D-7*011IGKVGenomic and rearranged1Homo sapiensATGGAACCATGGAAGCCCCAGCACAGCTTCTTCTTCCTCCTGCTACTCTGGCTCCCAGGTGAGGGGAATATGAGGTGGTTTTGCACATCAGTGAAAACTCCATCAGGAGTTTTCTCTGCTCAGCAAGAAATATAATTAAAATTCAAAGTAGATGAACAATTTTGGCTCTACTCAAAGACAGCTGGTTTGATCTAGATTACATGAGTGCATTTCTGTTTTATTTCCAATCTCAGATACCACCGGAGAAATTGTAATGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTATCCTGGTACCAGCAGAAACCTGGGCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCCCACAGTGATTCAACATGAAACAAAAACCGAAATTGTAATGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGC...............AGCAGCTACTTATCCTGGTACCAGCAGAAACCTGGGCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTGGCATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGGATTATAACTTACCTCC245534158234244323343395403512535562
IGKV4-1*01IGKV4-1*011IGKVGenomic and rearranged1Homo sapiensATGGTGTTGCAGACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGAGGAATTAAAAAGTGCCACAGTCTTTTCAGAGTAATATCTGTGTAGAAATAAAAAAAATTAAGATATAGTTGGAAATAATGACTATTTCCAATATGGATCCAATTATCTGCTGACTTATAATACTACTAGAAAGCAAATTTAAATGACATATTTCAATTATATCTGAGACAGCGTGTATAAGTTTATGTATAATCATTGTCCATTACTGACTACAGGTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCCCACAGTGCTTCAGCCTCGAACACAAACCGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCA.....................TCTACCCGGGAATCCGGGGTCCCT...GACCGATTCAGTGGCAGCGGG......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAATATTATAGTACTCCTCC280584149269279358393445453562585612
IGKV4-1*02IGKV4-1*021IGKVGenomic and rearranged1Homo sapiensATGGTGTTGCAGACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGAGGAATTAAAAAGTGCCACAGTCTTTTCAGAGTAATATCTGTGTAGAAATAAAAAAAATTAAGATATAGTTGGAAATAATGACTATTTCCAATATGGATCCAATTATCTGCTGACTTATAATACTACTAGAAAGCAAATTTAAATGACATATTTCAATTATATCTGAGACAGCGTGTATAAGTTTATGTATAATCATTGTCCATTACTGACTACAGGTGCCTACGGGGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCATCTACCCGGGAATCCGGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATAGTACTCCTCCCACAGTGCTTCAGCCTCGAACACAAACCGACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGTCCAGCCAGAGTGTTTTATACAGCTCCAACAATAAGAACTACTTAGCTTGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTACTGGGCA.....................TCTACCCGGGAATCCGGGGTCCCT...GACCGATTCAGTGGCAGCGGG......TCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAAGATGTGGCAGTTTATTACTGTCAGCAGTATTATAGTACTCCTCC280584149269279358393445453562585612
IGKV5-2*01IGKV5-2*011IGKVGenomic and rearranged1Homo sapiensATGGGGTCCCAGGTTCACCTCCTCAGCTTCCTCCTCCTTTGGATCTCTGGTAAGAGAAACACTTCCTCTCCTCTGTGCCACCAAGTCCCCTGCATATCCACAAAAATAATATATTTTCATAAGGAATTGATTTTCCTCATTCTCTGCAAATATGATGCATTTGATTTATGTTTTTTACTTTGCTCCATAATCAGATACCAGGGCAGAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTCCAGGAGACAAAGTCAACATCTCCTGCAAAGCCAGCCAAGACATTGATGATGATATGAACTGGTACCAACAGAAACCAGGAGAAGCTGCTATTTTCATTATTCAAGAAGCTACTACTCTCGTTCCTGGAATCCCACCTCGATTCAGTGGCAGCGGGTATGGAACAGATTTTACCCTCACAATTAATAACATAGAATCTGAGGATGCTGCATATTACTTCTGTCTACAACATGATAATTTCCCTCTCACAGTGATACACCCTGTTACAAAAACCGAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTCCAGGAGACAAAGTCAACATCTCCTGCAAAGCCAGCCAAGACATT..................GATGATGATATGAACTGGTACCAACAGAAACCAGGAGAAGCTGCTATTTTCATTATTCAAGAAGCT.....................ACTACTCTCGTTCCTGGAATCCCA...CCTCGATTCAGTGGCAGCGGG......TATGGAACAGATTTTACCCTCACAATTAATAACATAGAATCTGAGGATGCTGCATATTACTTCTGTCTACAACATGATAATTTCCCTCT206492149195205284301353361470493520
IGKV5-2*02IGKV5-2*021IGKVGenomic and rearranged1Homo sapiensATGGGGTCCCAGGTTCACCTCCTCAGCTTCCTCCTCCTTTGGATCTCTGGTAAGAGAAACACTTCCTCTCCTCTGTGCCACCAAGTCCCCTGCATCTCCACAAAAATAATATATTTTCATAAGGAATTGATTTTCCTCATTCTCTGCAAATATGATGCATTTGATTTATGTTTTTTACTTTGCTCCATAATCAGATACCAGGGCAGAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTCCAGGAGACAAAGTCAACATCTCCTGCAAAGCCAGCCAAGACATTGATGATGATATGAACTGGTACCAACAGAAACCAGGAGAAGCTGCTATTTTCATTATTCAAGAAGCTACTACTCTCGTTCCTGGAATCTCACCTCGATTCAGTGGCAGCGGGTATGGAACAGATTTTACCCTCACAATTAATAACATAGAATCTGAGGATGCTGCATATTACTTCTGTCTACAACATGATAATTTCCCTCTCACAGTGATACACCCTGTTACAAAAACCGAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTCCAGGAGACAAAGTCAACATCTCCTGCAAAGCCAGCCAAGACATT..................GATGATGATATGAACTGGTACCAACAGAAACCAGGAGAAGCTGCTATTTTCATTATTCAAGAAGCT.....................ACTACTCTCGTTCCTGGAATCTCA...CCTCGATTCAGTGGCAGCGGG......TATGGAACAGATTTTACCCTCACAATTAATAACATAGAATCTGAGGATGCTGCATATTACTTCTGTCTACAACATGATAATTTCCCTCT206492149195205284301353361470493520
IGKV6-21*01IGKV6-21*011IGKVGenomic Only1Homo sapiensATGTTGCCATCACAACTCATTGGGTTTCTGCTGCTCTGGGTTCCAGGTGAGAATATTTCCACAAACCTAGGCGGAGATATTCTTTCAATCTGTAATTTCTTTCATTGGGGACTCTGCAATAGGTGATTTTTGGCTTGATTTTAAAATCCTAATTTTAAAAATGTAATGCATATTCTTTCTTCATGTCTAGCAAGATTAAAGGTGATTTTCATACACAGATATTTATGTTGTACTGATGTTTGCTGTATATTTTCAGCCTCCAGGGGTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATTGGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCTTCCCAGTCCTTCTCAGGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCACACTGTGTTACAACCCAGAACAAAAACTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATT..................GGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCT.....................TCCCAGTCCTTCTCAGGGGTCCCC...TCGAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCA268554146257267346363415423532555582
IGKV6-21*02IGKV6-21*021IGKVGenomic and rearranged1Homo sapiensATGTTGCCATCACAACTCATTGGGTTTCTGCTGCTCTGGGTTCCAGGTGAGAATATTTCCACAAACCTAGGCGGAGATATTCTTTCAATCTGTAATTTCTTTCATTGGGGACTCTGCAATAGGTGATTTTTGGCTTGATTTTAAAATCCTAATTTTAAAAATGTAATGCATATTCTTTCTTCATGTCTAGCAAGATTAAAGGTGATTTTCATACACAGATATTTATGTTGTACTGATGTTTGCTGTATATTTTCAGCCTCCAGGGGTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATTGGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCTTCCCAGTCCATCTCAGGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCACACTGTGTTACAACCCAGAACAAAAACTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATT..................GGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCT.....................TCCCAGTCCATCTCAGGGGTCCCC...TCGAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCA268554257267346363415423532555582
IGKV6D-21*01IGKV6D-21*011IGKVGenomic Only1Homo sapiensATGTTGCCATCACAACTCATTGGGTTTCTGCTGCTCTGGGTTCCAGGTGAGAATATTTCCACAAACCTAGGCGGAGATATTCTTTCAATCTGTAATTTCTTTCATTGGGGACTCTGCAATAGGTGATTTTTGGCTTGATTTTAAAATCCTAATTTTAAAAATGTAATGCATATTCTTTCTTCATGTCTAGCAAGATTAAAGGTGATTTTCATACACAGATATTTATGTTGTACTGATGTTTGCTGTATATTTTCAGCCTCCAGGGGTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATTGGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCTTCCCAGTCCTTCTCAGGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCACACTGTGTTACAACCCAGAACAAAAACTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATT..................GGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCT.....................TCCCAGTCCTTCTCAGGGGTCCCC...TCGAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAACGTATTACTGTCATCAGAGTAGTAGTTTACCTCA268554146257267346363415423532555582
IGKV6D-21*02IGKV6D-21*021IGKVGenomic Only1Homo sapiensATGTCGCCATCACAACTCATTGGGTTTCTGCTGCTCTGGGTTCCAGGTGAGAATATTTCCACAAACCTAGGCGGAGATATTCTTTCAATCTGTAATTTCTTTCATTGGGGACTCTGCAATAGGTGATTTTTGGCTTGATTTTAAAATCCTAATTTTAAAAATGTAATGCATATTCTTTCTTCATGTCTAGCAAGATTAAAGGTGATTTTCATACACAGATATTTATGTTGTACTGATGTTTGCTGTATATTTTCAGCCTCCAGGGGTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATTGGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCTTCCCAGTCCATCTCAGGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAGCGTATTACTGTCATCAGAGTAGTAGTTTACCTCACACTGTGTTACAACCCAGAACAAAAACTGAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGCCGGGCCAGTCAGAGCATT..................GGTAGTAGCTTACACTGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAGTATGCT.....................TCCCAGTCCATCTCAGGGGTCCCC...TCGAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTGAAGATGCTGCAGCGTATTACTGTCATCAGAGTAGTAGTTTACCTCA268554146257267346363415423532555582
IGKV6D-41*01IGKV6D-41*011IGKVGenomic and rearranged1Homo sapiensATGGTGTCCCCGTTGCAATTCCTGCGGCTTCTGCTCCTCTGGGTTCCAGGTGAGAATATTTAGAAAAAGCTAAAACTAATTCTTTGAACCATTAATTTTCTTAATTAGGAACCTGGCACCATATGGAACTTGGCTTGTTTTTAAATGTGATTTTTTTTTAAGTAATGCGTATTCTTTCATCTTGTGCTACTAGATTAGTGGTGATTTCATTAAGCAGATGCTTATATTGTGCTAATGTTTGCTGTATGGTTTCAGCCTCCAGGGGTGATGTTGTGATGACACAGTCTCCAGCTTTCCTCTCTGTGACTCCAGGGGAGAAAGTCACCATCACCTGCCAGGCCAGTGAAGGCATTGGCAACTACTTATACTGGTACCAGCAGAAACCAGATCAAGCCCCAAAGCTCCTCATCAAGTATGCTTCCCAGTCCATCTCAGGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCTTTACCATCAGTAGCCTGGAAGCTGAAGATGCTGCAACATATTACTGTCAGCAGGGCAATAAGCACCCTCACACTGTGCTACAACCCAAAACAAAAATTGATGTTGTGATGACACAGTCTCCAGCTTTCCTCTCTGTGACTCCAGGGGAGAAAGTCACCATCACCTGCCAGGCCAGTGAAGGCATT..................GGCAACTACTTATACTGGTACCAGCAGAAACCAGATCAAGCCCCAAAGCTCCTCATCAAGTATGCT.....................TCCCAGTCCATCTCAGGGGTCCCC...TCGAGGTTCAGTGGCAGTGGA......TCTGGGACAGATTTCACCTTTACCATCAGTAGCCTGGAAGCTGAAGATGCTGCAACATATTACTGTCAGCAGGGCAATAAGCACCCTCA267553149256266345362414422531554581
IGLV3-21*04IGLV3-21*042IGLV3-21*i01IGLVGenomic and rearranged1Homo sapiensATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGTGATCCCCCCAGGGTCTCACCAACCTGCCCAGCCCAAGGGTTCTGGGTCCAGCGTGTCCTTGATTCTGAGCTCAGGAGGGCCCTTCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGGTGGGAGGCTGGTGGGGCTGAACTCCCCCCAAACTGTGCTCAAAGGCTTGTGAGAGCCTGAGGGACTGCACCTGCCAGGAGAGAGTAGTGAGTTTTCAGTTCAAAGTCTCCATACAACAGGAAAGTCATGGGCCACTGGGGCTGGGGCTGATTGCAGGGGATACCCTGAGGGTTCACAGACTCTCTGGAGCTTGTCTGGGACAGCAGGGCAAGGGATTTCATAAGAAGCATCTTTCACCTGCAAGCCAACCTCTCTCTCATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTTTATCTTTGCAGGCTCTGTGACCTCCTATGTGCTGACTCAGCCACCCTCAGTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCATCTATTATGATAGCGACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCCACGGTGACACAGGCAGATGAGGAAGTGAGACAAAAACATCCTATGTGCTGACTCAGCCACCCTCA...GTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGA..................AGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCATCTATTATGAT.....................AGCGACCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......TCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCAT..492779146481491567584636644753782820
IGLV3-25*03IGLV3-25*033IGLV3-25*i01IGLVGenomic and rearranged1Homo sapiensATGGCCTGGATCCCTCTACTTCTCCCCCTCCTCACTCTCTGCACAGGTGCTGTCCCCAGGCCCTGCTCCAGGCCCTGCTCCAGTCTTATTCCCCACAGATCCCAAGTTGAGCCTGCCCTGAATCCCGAGCAAAGCCCAGACACAGCCTCTGGGTGCGACTCCTGGGAATGGGTCCTTTGTCTTCAAGCCCCCTCTCTTGTTCTTCCTTGCAGGCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCAAAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCCCACAGTGACACAAGCAGACAGGGAAGTGAGACATAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCA..................AAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGAC.....................AGTGAGAGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAGC......TCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTAT..224511146213223299316368376485514552
IGLV7-46*04IGLV7-46*042IGLV7-46*i01IGLVGenomic and rearranged1Homo sapiensATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAGGTTAAGAGAGATTTCAAATACCAGCCTTTGGAGGGATCCCTTTTTCTCCCTTTCTAATTCCTAATATATGTCTGTTTTTTTGTTTCAGGGTCCAATTCCCAGGCTGTGGTGACTCAGGAGCCCTCACTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACCAGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACAAGCAACAAACACTCCTGGACCCCTGCCCGGTTCTCAGGCTCCCTCCTTGGGGGCAAAGCTGCCCTGACCCTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGGCACAGTGACAGACCCATGAGAGGAACCAAGACATAAACCCAGGCTGTGGTGACTCAGGAGCCCTCA...CTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACC.........AGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACA.....................AGCAACAAACACTCCTGGACCCCT...GCCCGGTTCTCAGGCTCCCTC......CTTGGGGGCAAAGCTGCCCTGACCCTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGG146439146135145221247299307416440478
IGLJ1*01IGLJ1*011IGLJGenomic Only1Homo sapiensGGTTTTGGTCTGAGCCTCAGTCACTGTGTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAGTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAG29661281
IGLJ2*01IGLJ2*011IGLJGenomic Only1Homo sapiensGGTTTTTGTATGAGCCTGTGTCACAGTGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG29661281
IGLJ3*01IGLJ3*011IGLJGenomic Only1Homo sapiensGGTTTTTGTATGAGCCTGTGTCACAGTGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAG29661280
IGLJ3*02IGLJ3*021IGLJGenomic Only1Homo sapiensGGTTTTTGTATGAGCCTGTGTCACAGTGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGTTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAG29661281
IGLJ4*01IGLJ4*011IGLJGenomic Only1Homo sapiensAGTTTTTGTATGAACCTGTGTCACCGCATTTTGTATTTGGTGGAGGAACCCAGCTGATCATTTTAGTTTTGTATTTGGTGGAGGAACCCAGCTGATCATTTTAG29661280
IGLJ5*01IGLJ5*011IGLJGenomic Only1Homo sapiensGGTTTTTGTATGAGCCTGTGTCACAGCACTGGGTGTTTGGTGAGGGGACCGAGCTGACCGTCCTAGCTGGGTGTTTGGTGAGGGGACCGAGCTGACCGTCCTAG29661280
IGLJ5*02IGLJ5*021IGLJGenomic Only1Homo sapiensGGTTTTTGTATGAGCCTGTGTCACAGCACTGGGTGTTTGGTGAGGGGACGGAGCTGACCGTCCTAGCTGGGTGTTTGGTGAGGGGACGGAGCTGACCGTCCTAG29661280
IGLJ6*01IGLJ6*011IGLJGenomic Only1Homo sapiensGGTTTGTGTGCAGGGTTATATCACAGTGTAATGTGTTCGGCAGTGGCACCAAGGTGACCGTCCTCGTAATGTGTTCGGCAGTGGCACCAAGGTGACCGTCCTCG29661281
IGLJ7*01IGLJ7*011IGLJGenomic Only1Homo sapiensGGTTTGTGTGTGGGGCTGTGTCACTGTGTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCGTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCG29661281
IGLJ7*02IGLJ7*021IGLJGenomic Only1Homo sapiensGGTTTGTGTGTGGGGCTGTGTCACTGTGTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGCCCTCGTGCTGTGTTCGGAGGAGGCACCCAGCTGACCGCCCTCG29661281
IGLV1-36*01IGLV1-36*011IGLVGenomic Only1Homo sapiensATGGCCTGGTCCCCTCTCTTCCTCACCCTCATCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAGAGAGGCCCTGGGAAGCCCATGCGACCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCGGTGTCTGAAGCCCCCAGGCAGAGGGTCACCATCTCCTGTTCTGGAAGCAGCTCCAACATCGGAAATAATGCTGTAAACTGGTACCAGCAGCTCCCAGGAAAGGCTCCCAAACTCCTCATCTATTATGATGATCTGCTGCCCTCAGGGGTCTCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCCCACAGTGCTCCAGGCCCAGGGGGAACAGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCG...GTGTCTGAAGCCCCCAGGCAGAGGGTCACCATCTCCTGTTCTGGAAGCAGCTCCAACATC............GGAAATAATGCTGTAAACTGGTACCAGCAGCTCCCAGGAAAGGCTCCCAAACTCCTCATCTATTATGAT.....................GATCTGCTGCCCTCAGGGGTCTCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCC173468146162172248271323331440469507
IGLV1-40*01IGLV1-40*011IGLVGenomic Only1Homo sapiensATGGCCTGGTCTCCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGTGACTGGATACAGGTCCAGGGGAGGGGCCCTGGGAAGCCTATGGATTCTTGCTTTCTCCTGTTGTCTCTAGAAGCCGAATAATGATGCCTGTGTCTCTCCCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGCTCCAACATCGGGGCAGGTTATGATGTACACTGGTACCAGCAGCTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAACAGCAATCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTCCACAGTGCTCCAGGCCCGGGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACGCAGCCGCCCTCA...GTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGCTCCAACATCGGG.........GCAGGTTATGATGTACACTGGTACCAGCAGCTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAAC.....................AGCAATCGGCCCTCAGGGGTCCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGGTTC168466146157167243269321329438467505
IGLV1-41*01IGLV1-41*011IGLVGenomic Only1Homo sapiensCAGTCTGTGTTGACGCAGCCGCCTTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCGACATGGGGAATTATGCGGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCACCCTGGGCATCACTGGCCTCTGGCCTGAGGACGAGGCCGATTATTACTGCTTAGCATGGGATACCAGCCCGAGAGCTTGCAGTCTGTGTTGACGCAGCCGCCTTCA...GTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCGACATG............GGGAATTATGCGGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAAT.....................AATAAGCGACCCTCAGGGATTCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCACCCTGGGCATCACTGGCCTCTGGCCTGAGGACGAGGCCGATTATTACTGCTTAGCATGGGATACCAGCCCGAGAGCTTG12967699151159268
IGLV1-41*02IGLV1-41*021IGLVGenomic Only1Homo sapiensATGACCTGCTCCCCTCTCCTCCTCACCCTTCTCATTCACTGCACAGGTGCCCAGACACAGGGTCAGGGGAGGGGTCCAGGAAGCCCATGAGGCCCTGCTTTCTCCTTCTCTCTCTAGACCAAGAATCACCGTGTCTGTGTCTCTCCTGCTTCCACGGTCCTGGGCCCAGTCTGTGTTGACGCAGCCGCCTTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCGACATGGGGAATTATGCGGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCACCCTGGGCATCACTGGCCTCTGGCCTGAGGACTAGGCCGATTATTACTGCTTAGCATGGGATACCAGCCTGAGAGCTTGCACAGTGCTCCAGGCCAATGGGGAACTGAGACAAGAACCCAGTCTGTGTTGACGCAGCCGCCTTCA...GTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCGACATG............GGGAATTATGCGGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAAT.....................AATAAGCGACCCTCAGGGATTCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCACCCTGGGCATCACTGGCCTCTGGCCTGAGGACTAGGCCGATTATTACTGCTTAGCATGGGATACCAGCCTGAGAGCTTG167462148156166242265317325434463501
IGLV1-44*01IGLV1-44*011IGLVGenomic Only1Homo sapiensATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAAAGGGGCCCTGGGAAGCCCATGGGGCCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCCCACAGTGCTCCAGGCCAATGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCA...GCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATC............GGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAAT.....................AATCAGCGGCCCTCAGGGGTCCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCC173468146162172248271323331440469507
IGLV1-44*02IGLV1-44*021IGLVGenomic Only1Homo sapiensATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAAAGGGGCCCTGGGAAGCCCATGGGGCCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGGCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCCCACAGTGCTCCAGGCCTGGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCA...GCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATC............GGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGGCCCCAAACTCCTCATCTATAGTAAT.....................AATCAGCGGCCCTCAGGGGTCCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCC173468146162172248271323331440469506
IGLV1-44*03IGLV1-44*031IGLVGenomic Only1Homo sapiensATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAAAGGGGCCCTGGGAAGCCCATGGGGCCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCTTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCCCACAGTGCTCCAGGCCAATGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCA...GCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATC............GGAAGTAATACTGTAAACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAAT.....................AATCAGCGGCCCTCAGGGGTCCTT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAATGGTCC173468146162172248271323331440469507
IGLV1-47*02IGLV1-47*021IGLVGenomic Only1Homo sapiensATGGCCGGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAGAGGGGCCCTGGGAAGCCCATGGGGCCCTGCTTTCTCCTCTTGTCTCCTTTCGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATTATGTATACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCCCACAGTGCTCCAGGCCCAGGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCA...GCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATC............GGAAGTAATTATGTATACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGTAAT.....................AATCAGCGGCCCTCAGGGGTCCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCC173468146162172248271323331440469507
IGLV1-50*01IGLV1-50*011IGLVGenomic Only1Homo sapiensATGGCCTGGTCTTCTCTCCTCCTCACTCTCCTCGCTCACTGCACAGGTGACTGGATGCAGATCGAGGGGAGGGTCCCTGGGAAGCCTATGGATTCTTGCTTTCTCCTCTTGTCTCTAGAAGCAGAATCATGATGCCTGTGTCTCTCCCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGCTCCAACATTGGGGCGGGTTATGTTGTACATTGGTACCAGCAGCTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAACAGCAATCGGCCCTCAGGGGTCCCTGACCAATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGACTCCAGTCTGAGGATGAGGCTGATTATTACTGCAAAGCATGGGATAACAGCCTGAATGCTCACACAGTGCTCCAGGCCCAGGGGGAGGTGAGAGAAGAACCCAGTCTGTGCTGACGCAGCCGCCCTCA...GTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGCTCCAACATTGGG.........GCGGGTTATGTTGTACATTGGTACCAGCAGCTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAAC.....................AGCAATCGGCCCTCAGGGGTCCCT...GACCAATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCACTGGACTCCAGTCTGAGGATGAGGCTGATTATTACTGCAAAGCATGGGATAACAGCCTGAATGCTCA168466146157167243269321329438467505
IGLV1-51*01IGLV1-51*011IGLVGenomic Only1Homo sapiensATGACCTGCTCCCCTCTCCTCCTCACCCTTCTCATTCACTGCACAGGTGCCCAGACACAGGGTCAGGGGAGGGGTCCAGGAAGCCCATGAGGCCCTGCTTTCTCCTTCTCTCTCTAGACCAAGAATCACCGTGTCTGTGTCTCTCCTGCTTCCAGGGTCCTGGGCCCAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGCACAGTGCTCCAGCCCAATGGGGAACTGAGACAAGAACCCAGTCTGTGTTGACGCAGCCGCCCTCA...GTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATT............GGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAAT.....................AATAAGCGACCCTCAGGGATTCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGG167462146156166242265317325434463501
IGLV10-54*02IGLV10-54*021IGLVGenomic Only1Homo sapiensATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGGTGAGAGTGGACCTTACCCAGGGATCTGCACCCACCTCTGCTCCAGCTTCTCCACTCCCTGGCTCAGTGGACTCTGATCCTGCTCTCACATTCCTTTCTGTCCCCTCTACAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACATTGTTGGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAATAACAACCGGCCCTCAGGGATCTCAGAGAGATTCTCTGCATCCAGGTCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATTGGACAGCAGCCTCAGTGCTCACACAGTGCCTCAGGCCAGTGGGGAAGTGAGATAAAAACTCAGGCAGGGCTGACTCAGCCACCCTCG...GTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACATTGTT............GGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAAT.....................AACAACCGGCCCTCAGGGATCTCA...GAGAGATTCTCTGCATCCAGG......TCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATTGGACAGCAGCCTCAGTGCTCA170465146159169245268320328437466504
IGLV11-55*01IGLV11-55*011IGLVGenomic Only1Homo sapiensATGGCCCTGACTCCTCTCCTCCTCCTGCTCCTCTCTCACTGCACAGGTAGGGACAGGGCTCAGAGCCCAGGGTGGTCCCCAGCCTGATCTGTCCCTCATGGCTCAGATCCCTCAGCAGCTGCGCCCTGACCCTGCTCCTCACTGTGCTGTGTCTGTGTCTGCAGGTTCCCTCTCCCGGCCCGTGCTGACTCAGCCGCCCTCTCTGTCTGCATCCCCGGGAGCAACAGCCAGACTCCCCTGCACCCTGAGCAGTGACCTCAGTGTTGGTGGTAAAAACATGTTCTGGTACCAGCAGAAGCCAGGGAGCTCTCCCAGGTTATTCCTGTATCACTACTCAGACTCAGACAAGCAGCTGGGACCTGGGGTCCCCAGTCGAGTCTCTGGCTCCAAGGAGACCTCAAGTAACACAGCGTTTTTGCTCATCTCTGGGCTCCAGCCTGAGGACGAGGCCGATTATTACTGCCAGGTGTACGAAAGTAGTGCTAATCACAGTGAGACAGATGAGGAAGTCGGACAAAAACCAAGCGGCCCGTGCTGACTCAGCCGCCCTCT...CTGTCTGCATCCCCGGGAGCAACAGCCAGACTCCCCTGCACCCTGAGCAGTGACCTCAGTGTT.........GGTGGTAAAAACATGTTCTGGTACCAGCAGAAGCCAGGGAGCTCTCCCAGGTTATTCCTGTATCACTACTCAGAC.........TCAGACAAGCAGCTGGGACCTGGGGTCCCC...AGTCGAGTCTCTGGCTCCAAGGAGACCTCAAGTAACACAGCGTTTTTGCTCATCTCTGGGCTCCAGCCTGAGGACGAGGCCGATTATTACTGCCAGGTGTACGAAAGTAGTGCTAAT176487146165175251277329349464488525
IGLV11-55*02IGLV11-55*021IGLVGenomic Only1Homo sapiensATGGCCCTGACTCCTCTCCTCCTCCTGCTCCTCTCTCACTGCACAGGTAGGGACAGGGCTCAGAGCCCAGGGTGGTCCCCAGCCTGATCTGTCCCTCATGGCTCAGATCCCTCAGCAGCTGCGCCCTGACCCTGCTCCTCACTGTGCTGTGTCTGTGTCTGCAGGTTCCCTCTCCCGGCCCGTGCTGACTCAGCCGCCCTCCCTGTCTGCATCCCCGGGAGCAACAGCCAGACTCCCCTGCACCCTGAGCAGTGACCTCAGTGTTGGTGGTAAAAACATGTTCTGGTACCAGCAGAAGCTAGGGAGCTCTCCCAGGTTATTCCTGTATCACTACTCAGACTCAGACAAGCAGCTGGGACCTGGGGTCCCCAGTCGAGTCTCTGGCTCCAAGGAGACCTCAAGTAACACAGCGTTTTTGCTCATCTCTGGGCTCCAGCCTGAGGACGAGGCCGATTATTACTGCCAGGTGTACGAAAGTAGTGCTAATCACAGTGAGACAGATGAGGAAGTCGGACAAAAACCAAGCGGCCCGTGCTGACTCAGCCGCCCTCC...CTGTCTGCATCCCCGGGAGCAACAGCCAGACTCCCCTGCACCCTGAGCAGTGACCTCAGTGTT.........GGTGGTAAAAACATGTTCTGGTACCAGCAGAAGCTAGGGAGCTCTCCCAGGTTATTCCTGTATCACTACTCAGAC.........TCAGACAAGCAGCTGGGACCTGGGGTCCCC...AGTCGAGTCTCTGGCTCCAAGGAGACCTCAAGTAACACAGCGTTTTTGCTCATCTCTGGGCTCCAGCCTGAGGACGAGGCCGATTATTACTGCCAGGTGTACGAAAGTAGTGCTAAT176487146165175251277329349464488525
IGLV2-11*01IGLV2-11*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTCCTCCTCAGCCTCCTCACTCAGGGCACAGGTGACACCTCCAGGGAAAGGGTCACAGGGGTCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCTGGGCCCAGCACTGACTCACTAGAGTGTGTTTCTCCCTCTTTCCAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCGCTCAGTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTTTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTCGCTCA...GTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTC.....................AGTAAGCGGCCCTCAGGGGTCCCT...GATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCTGCTCATATGCAGGCAGCTACACTTTC175471146164174250276328336445472510
IGLV2-14*04IGLV2-14*041IGLVUnrearranged and Rearranged1Homo sapiensnoneATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGTGATGCCTCCAGGGAAGGGGCTTCGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCAGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTC.....................AGTAATCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTC1754711461641742502763283364454725101
IGLV2-14*05IGLV2-14*051IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGTGACGCCTCCAGGGAAGGGGCTTCAGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAATCGGCCCTCAGGGGTCCCT...GATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTC175471146164174250276328336445472510
IGLV2-18*01IGLV2-18*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGTGAGGCCTCCAGGGAAGGGGCTTCGGGGACCTCTGGGCTGATCCTTAACTCCTGCTCCTCAGGCTCACCTGGGCCCAGCACTGACTTACTAAAATGTGTTTCTTCCTTTTTCCAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCCCTCCGTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTAGTTATAACCGTGTCTCCTGGTACCAGCAGCCCCCAGGCACAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGGTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTTATATACAAGCAGCAGCACTTTCCACAGAGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTCCCTCC...GTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........AGTTATAACCGTGTCTCCTGGTACCAGCAGCCCCCAGGCACAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAATCGGCCCTCAGGGGTCCCT...GATCGCTTCTCTGGGTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTTATATACAAGCAGCAGCACTTTC174470146163173249275327335444471509
IGLV2-23*03IGLV2-23*031IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTGCTCCTCACTCTCCTCACTCAGGACACAGGTGACGCCTCCAGGGAAGGGGTCTTGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGGAGTTATAACCTTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGGCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTCCACAGTGGTCCAAGTTCATGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGG.........AGTTATAACCTTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGGC.....................AGTAAGCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTC175471146164174250276328336445472510
IGLV2-33*01IGLV2-33*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGTGACACCTCCAGGGAAATGGCCTTGGGGACCTCTGAGCTGATGCTTGGTCTTCTGCTCCTGCTCCTCAGGGTCACTGGACCCAGTACTGACCCAGTAGAGTGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAATCTGCCCTGACTCAGCCTCCTTTTGTGTCCGGGGCTCCTGGACAGTCGGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGGGATTATGATCATGTCTTCTGGTACCAAAAGCGTCTCAGCACTACCTCCAGACTCCTGATTTACAATGTCAATACTCGGCCTTCAGGGATCTCTGACCTCTTCTCAGGCTCCAAGTCTGGCAACATGGCTTCCCTGACCATCTCTGGGCTCAAGTCCGAGGTTGAGGCTAATTATCACTGCAGCTTATATTCAAGTAGTTACACTTTCCATAGTGGTCCAAGTTCCTAGGGAACTGAGACCAAAACCCAATCTGCCCTGACTCAGCCTCCTTTT...GTGTCCGGGGCTCCTGGACAGTCGGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGG.........GATTATGATCATGTCTTCTGGTACCAAAAGCGTCTCAGCACTACCTCCAGACTCCTGATTTACAATGTC.....................AATACTCGGCCTTCAGGGATCTCT...GACCTCTTCTCAGGCTCCAAG......TCTGGCAACATGGCTTCCCTGACCATCTCTGGGCTCAAGTCCGAGGTTGAGGCTAATTATCACTGCAGCTTATATTCAAGTAGTTACACTTTC180476146169179255281333341450477515
IGLV2-8*01IGLV2-8*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGTGATGCCTCCAGGGAAGGGGCCACAGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCTGGGCCCAGCACTGACTCACTAGACTGTGTTTCTCCCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAAGCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCGTCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTTCCACAGTGTTTTAAGTCAATGAGGAAGTAAGATCAAAACCCAGTCTGCCCTGACTCAGCCTCCCTCC...GCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAAGCGGCCCTCAGGGGTCCCT...GATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCGTCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTTC173469146162172248274326334443470508
IGLV3-1*01IGLV3-1*011IGLVGenomic Only1Homo sapiensATGGCATGGATCCCTCTCTTCCTCGGCGTCCTTGCTTACTGCACAGGTGCTGCCCCTAGGGTCCTAGCCACTGGTCCAGTCCCAGGGCTCTGGGTCCAGCCTGGCCCTGACTCTGAGCTCAGCAGGGCCCCCGCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGTGGATGGGCTCGGCGGGGCTGAAATCCCCCCACACAGTGCTCATGTGCTCACACTGCCTTAGGGCTCTTTCATCCCTGGATCTGTGTCCAGGCCAGGCACGTGGGAAGATTTACTTGGAGTTCAGCTCCTCAGTTTCAAGCCTTTTCTCTCCCGTTTTCTCTCCTGTAGGATCCGTGGCCTCCTATGAGCTGACTCAGCCACCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCAGCATCACCTGCTCTGGAGATAAATTGGGGGATAAATATGCTTGCTGGTATCAGCAGAAGCCAGGCCAGTCCCCTGTGCTGGTCATCTATCAAGATAGCAAGCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCACACAGTGACACAGGCAGATGCGGAAGTGAGACAGAAACCTCCTATGAGCTGACTCAGCCACCCTCA...GTGTCCGTGTCCCCAGGACAGACAGCCAGCATCACCTGCTCTGGAGATAAATTGGGG..................GATAAATATGCTTGCTGGTATCAGCAGAAGCCAGGCCAGTCCCCTGTGCTGGTCATCTATCAAGAT.....................AGCAAGCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......TCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCA351635146340350426443495503612636674
IGLV3-10*01IGLV3-10*011IGLVGenomic Only1Homo sapiensATGGCCTGGACCCCTCTCCTGCTCCCCCTCCTCACTTTCTGCACAGGTGCTTCTCCCAGGCCCTGCCCCAGGCTCAGTGCCCATAGACCCCAAGTTGGCCCTGCCCTGAACCCTGTGCAAAGCCCAGACACAGTCTTAGGGTAGGACCCCTGGGAATGGGCTCTTGATCTTCAAGCCCCCTCTCCTGTTTTCCTTGCAGTCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAAACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCAAAAAAATATGCTTATTGGTACCAGCAGAAGTCAGGCCAGGCCCCTGTGCTGGTCATCTATGAGGACAGCAAACGACCCTCCGGGATCCCTGAGAGATTCTCTGGCTCCAGCTCAGGGACAATGGCCACCTTGACTATCAGTGGGGCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCATAGCACAGTGACACTGGCAGATGGGGAAGTGAGACACAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCCAGGACAAACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCA..................AAAAAATATGCTTATTGGTACCAGCAGAAGTCAGGCCAGGCCCCTGTGCTGGTCATCTATGAGGAC.....................AGCAAACGACCCTCCGGGATCCCT...GAGAGATTCTCTGGCTCCAGC......TCAGGGACAATGGCCACCTTGACTATCAGTGGGGCCCAGGTGGAGGATGAAGCTGACTACTACTGTTACTCAACAGACAGCAGTGGTAATCATAG211500146200210286303355363472501539
IGLV3-12*02IGLV3-12*021IGLVGenomic Only1Homo sapiensATGGCCTGGACCCCTCTCCTCCTCAGCCTCCTCGCTCACTGCACAGGTGCTCTGCCCAGGGTATCACCAACCTGCCCATCCCCAGGGCTCTGGGTCCAGTGTGGCCATGACTATGAGCTCAGGAGGGCCCTGCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGGTGAGGGACTGGCGGAGCTGAAGTCCCCTCAAACTCTGCTCAGAGGCTTGTGAGAGCCTGAGGGGCTGCACCTGCCAGGAGAGAGTACTGGGTTTTCAGTTCAAAGGCTCCATGCAGAGGGAAAGTCCATGGGCCACTGGGGCTAGGGCTGATTGCAGGGGATACCCTGAGGGTTCACAGACTCTCTGAAGCTTTTCCAGGACAGCAGGGCAGGGGATTTCATACGGATCTTTTACCTAAAAGCCATCCTCTCCTTTTTTTTTTTTTTTAATCTTTGCAGGCTCTGCGACCTCCTATGAGCTGACTCAGCCACACTCAGTGTCAGTGGCCACAGCACAGATGGCCAGGATCACCTGTGGGGGAAACAACATTGGAAGTAAAGCTGTGCACTGGTACCAGCAAAAGCCAGGCCAGGACCCTGTGCTGGTCATCTATAGCGATAGCAACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACCCAGGGAACACCGCCACCCTAACCATCAGCAGGATCGAGGCTGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGTAGTAGTGATCATCCCACGGTGACACAGGCAGATGGGGAAGTGAGACAAAAACATCCTATGAGCTGACTCAGCCACACTCA...GTGTCAGTGGCCACAGCACAGATGGCCAGGATCACCTGTGGGGGAAACAACATTGGA..................AGTAAAGCTGTGCACTGGTACCAGCAAAAGCCAGGCCAGGACCCTGTGCTGGTCATCTATAGCGAT.....................AGCAACCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......CCAGGGAACACCGCCACCCTAACCATCAGCAGGATCGAGGCTGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGTAGTAGTGATCATCC461750146450460536553605613722751789
IGLV3-13*01IGLV3-13*011IGLVGenomic Only1Homo sapiensTGGCCTGGACCCCCTCTCTGCCTCTCCTTCCTCACCCTCTACAAAGGTGATGCCCCCAACCCTGCCTTAGGCTCAGCCCTTACAGGATCCTGAGCTGGTCCTGCCCTGAACCCTGAGCTCAGCCTAGGCATAGCCTCAGGGTGACACCACTGGAAATGTGTTTGTTATCTTCAAGCCCCCTCTCCTTTCCTCTCCTGCAGGCTCTGTGGCCTCCTATGAGCTGACACAGCCACCCGCGGTGTCAGTGTCCCCAGGACAGACAGCCAGGATCAGCTGCTCTGGAGATGTACTGAGGGATAATTATGCTGACTGGTACCCGCAAAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGATGGTGAGCGGCCCTCTGGAATCCCTGAGCGATTCTCTGGGTCCACCTCAGGGAACACAACCGCCCTGACCATTAGCAGGGTCCTGACCAAAGGCGGGGCTGACTATTACTGTTTTTCTGGTGATTAGAACAATCTCACAGTGACACAGGCAGATGGGGAAGTGAGACACAAATCTCCTATGAGCTGACACAGCCACCCGCG...GTGTCAGTGTCCCCAGGACAGACAGCCAGGATCAGCTGCTCTGGAGATGTACTGAGG..................GATAATTATGCTGACTGGTACCCGCAAAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGAT.....................GGTGAGCGGCCCTCTGGAATCCCT...GAGCGATTCTCTGGGTCCACC......TCAGGGAACACAACCGCCCTGACCATTAGCAGGGTCCTGACCAAAGGCGGGGCTGACTATTACTGTTTTTCTGGTGATTAGAACAATCT212495146201211287304356364473496534
IGLV3-16*01IGLV3-16*011IGLVGenomic Only1Homo sapiensATGGCCTGGATCCCTCTCCTGCTCCCCCTCCTCACTCTCTGCACAGGTGCTGACCCCAGGCCCTTCCCCAGGCTCAGTCCCCACAGATTCCAAGTTGAGCCTGACCTGAATCCTGAGCAAAGCCCAGACACAGCCTCTGGGTGGGACTCCTGGAAATGGGTCCTTTGTCTTCAAGCCCCCTCTCTTGTTCTTCCTTGCAGGCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCTAGGACAGATGGCCAGGATCACCTGCTCTGGAGAAGCATTGCCAAAAAAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGTTCCCTGTGCTGGTGATATATAAAGACAGCGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAATAGTCACATTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCTATCAGCAGACAGCAGTGGTACTTATCCCACAGTGACACAAGGAGACAGGGAAGTGAAACATAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCTAGGACAGATGGCCAGGATCACCTGCTCTGGAGAAGCATTGCCA..................AAAAAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGTTCCCTGTGCTGGTGATATATAAAGAC.....................AGCGAGAGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAGC......TCAGGGACAATAGTCACATTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCTATCAGCAGACAGCAGTGGTACTTATCC212501146201211287304356364473502540
IGLV3-19*01IGLV3-19*011IGLVGenomic Only1Homo sapiensATGGCCTGGACCCCTCTCTGGCTCACTCTCCTCACTCTTTGCATAGGTGCTGCCTCCCAGGGCTCAACCCCATATTATCATGCTAGCTGTGCCAACCTGGCCCTGAGCTTCGGCTCAACACAGGGAGTAGTGTAGGGTGTGGGACTCTAGGCGTGAAACCCTTATCCTCACCTCTTCTGTCCTCTTTTGCAGGTTCTGTGGTTTCTTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATCTCACATTGACACAGACAGATGGGGAAGTGAGACAGAAACCTCTTCTGAGCTGACTCAGGACCCTGCT...GTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGA..................AGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAA.....................AACAACCGGCCCTCAGGGATCCCA...GACCGATTCTCTGGCTCCAGC......TCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATCT204493146193203279296348356465494532
IGLV3-2*03IGLV3-2*031IGLVGenomic Only1Homo sapiensATGAAGAGCCTTCCCTTTCTAAGAGTCCTGGAAACCCACTGTCTAGTTGTGGAATCAGAGGCAGAGCTCTGGGGCATCTCCACCATGGCCTGGACCCTCCCCTGCTCACCCTCCCGACTCTCTGCATAGGTGCTTCCTCCCAGGGAATAAGCCCCATGGAACCAGGGGTCAGCCTGGCCCTGACCTTGAGCTCAGTGCAGGGAGTGATGCAGGGTGTGGGGCTATGGGAATGAGACCCTAATTCTCAGTCTCACGTCTCCTGTCTCCTCTTGCAGGCTGTGTGGCCTCCTCTGAGCTGACTCAGCTGCCTGCAGTGTCTGTGGCTTTGGGACGTACGGCCAGGATCATCTGCCAGGGAGATAGCATAGGTGACTCTGATACAAACTCGTACCAGCAGAAGCCAGGTCAGGTCCCTGTGCTGGTAATTTATGGTGACAGCAACCAGCCCTCAGTGATTCCTGAGCAATTTTCTGACTGCATATCAGAGGACATGGCCACCTTGATTATTAATGGGGCACAGGATGGAAACAAGGCTATTACTGTCGCTCGGAACAGCACTGCTTCTCATCTCACAGTGACACAGCATACAGTGAAGTGAGATGCAAACCTCCTCTGAGCTGACTCAGCTGCCTGCA...GTGTCTGTGGCTTTGGGACGTACGGCCAGGATCATCTGCCAGGGAGATAGCATAGGT..................GACTCTGATACAAACTCGTACCAGCAGAAGCCAGGTCAGGTCCCTGTGCTGGTAATTTATGGTGAC.....................AGCAACCAGCCCTCAGTGATTCCT...GAGCAATTTTCTGACTGCATA......TCAGAGGACATGGCCACCTTGATTATTAATGGGGCACAGGATGGAAACAAGGCTATTACTGTCGCTCGGAACAGCACTGCTTCTCATCT287570140276286362379431439548571608
IGLV3-21*02IGLV3-21*021IGLVGenomic Only1Homo sapiensATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGTGATCCCCCCAGGGTCTCACCAACCTGCCCAGCCCAAGGGTTCTGGGTCCAGCGTGTCCTTGATTCTGAGCTCAGGAGGGCCCTTCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGGTGGGAGGCTGGTGGGGCTGAACTCCCCCCAAACTGTGCTCAAAGGCTTGTGAGAGCCTGAGGGACTGCACCTGCCAGGAGAGAGTAGTGAGTTTTCAGTTCAAAGTCTCCATACAACAGGAAAGTCATGGGCCACTGGGGCTGGGGCTGATTGCAGGGGATACCCTGAGGGTTCACAGACTCTCTGGAGCTTGTCTGGGACAGCAGGGCAAGGGATTTCATAAGAAGCATCTTTCACCTGCAAGCCAACCTCTCTCTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTTTATCTTTGCAGGCTCTGTGACCTCCTATGTGCTGACTCAGCCACCCTCGGTGTCAGTGGCCCCAGGACAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCGTCTATGATGATAGCGACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCCACGGTGACACAGGCAGATGAGGAAGTGAGACAAAAACATCCTATGTGCTGACTCAGCCACCCTCG...GTGTCAGTGGCCCCAGGACAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGA..................AGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCGTCTATGATGAT.....................AGCGACCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......TCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCC492781146481491567584636644753782820
IGLV3-21*03IGLV3-21*031IGLVGenomic Only1Homo sapiensATGGCCTGGACCTTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAGGTGATCCCCCCAGGGTCTCACCAACCTGCCCAGCCCAAGGGTTCTGGGTCCAGCGTGTCCTTGATTCTGAGCTCAGGAGGGCCCTTCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGGTGGGAGGCTGGTGGGGCTGAACTCCCCCCAAACTGTGCTCAAAGGCTTGTGAGAGCCTGAGGGACTGCACCTGCCAGGAGAGAGTAGTGAGTTTTCAGTTCAAAGTCTCCATACAACAGGAAAGTCATGGGCCACTGGGGCTGGGGCTGATTGCAGGGGATACCCTGAGGGTTCACAGACTCTCTGGAGCTTGTCTGGGACAGCAGGGCAAGGGATTTCATAAGAAGCATCTTTCACCTGCAAGCCAACCTCTCTCTCATTTATTTATTTATTTATTTATTTATTTATTTTTATCTTTGCAGGCTCTGTGACCTCCTATGTGCTGACTCAGCCACCCTCGGTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCGTCTATGATGATAGCGACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCCCACGGTGACACAGGCAGATGAGGAAGTGAGACAAAAACATCCTATGTGCTGACTCAGCCACCCTCG...GTGTCAGTGGCCCCAGGAAAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGA..................AGTAAAAGTGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCGTCTATGATGAT.....................AGCGACCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......TCTGGGAACACGGCCACCCTGACCATCAGCAGGGTCGAAGCCGGGGATGAGGCCGACTATTACTGTCAGGTGTGGGATAGTAGTAGTGATCATCC484773146473483559576628636745774812
IGLV3-22*01IGLV3-22*011IGLVGenomic Only1Homo sapiensATGGCATGGGCCACACTCCTGCTCCCACTCCTCAACCTCTACACAGGTGCTGCCCCCAGACCCTGCCCCAGGCTCAGCCCTCCTAAGCCCCTGGTCTTACCCTGAACCCTGAGCTCAGCCCAGGCATAGCCTCAGGGCGATACTACTGGAATGGGTTTGTTATCTTCAAGCCCCCTCTCTTGTCCTCTCTTGCAGGCTCTGTTGCCTCCTATGAGCTGACACAGCTACCCTCGGTGTCAGTGTCCCCAGGACAGACAGCCAGGATCACCTGCTCTGGAGATGTACTGGGGGAAAATTATGCTGACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGAGTTGGTGATATACGAAGATAGTGAGCGGTACCCTGGAATCCCTGAACGATTCTCTGGGTCCACCTCAGGGAACACGACCACCCTGACCATCAGCAGGGTCCTGACCGAAGACGAGGCTGACTATTACTGTTTGTCTGGGGATGAGGACAATCCCTCAGTGACACAGGCAGATGGGGAAGTGAGACACAAACTTCCTATGAGCTGACACAGCTACCCTCG...GTGTCAGTGTCCCCAGGACAGACAGCCAGGATCACCTGCTCTGGAGATGTACTGGGG..................GAAAATTATGCTGACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGAGTTGGTGATATACGAAGAT.....................AGTGAGCGGTACCCTGGAATCCCT...GAACGATTCTCTGGGTCCACC......TCAGGGAACACGACCACCCTGACCATCAGCAGGGTCCTGACCGAAGACGAGGCTGACTATTACTGTTTGTCTGGGGATGAGGACAATCC207490146196206282299351359468491529
IGLV3-25*02IGLV3-25*021IGLVGenomic Only1Homo sapiensATGGCCTGGATCCCTCTACTTCTCCCCCTCTTCACTCTCTGCACAGGTGCTGTCCCCAGGCCCTGCTCCAGGCCCTGCTCCAGTCTTATTCCCCACAGATCCCAAGTTGAGCCTGCCCTGAATCCCGAGCAAAGCCCAGACGCAGCCTCTGGGTGCGACTCCTGGGAATGGGTCCTTTGTCTTCAAGCCCCCTCTCTTGTTCTTCCTTGCAGGCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCAAAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGATGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCCCACAGTGACACAAGCAGACAGGGAAGTGAGACATAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCA..................AAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGAC.....................AGTGAGAGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAGC......TCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGATGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCC224513146213223299316368376485514552
IGLV3-27*01IGLV3-27*011IGLVGenomic Only1Homo sapiensATGGCCTGGATCCCTCTCCTGCTCCCCCTCCTCATTCTCTGCACAGGTGCTGCCCCTAGGCTCAGTCTCCACAGACCCCAAGTTGAGCCTGACCTGAATCCTGAGCAAAGCCCTGCCACTGCCTCTGGGGGGGATTCCTGGCAATGCGTCCTTTGTCCTCAAGCCCCCTCTCCTGTCTTTTCTTGCAGTCTCTGTGGCCTCCTATGAGCTGACACAGCCATCCTCAGTGTCAGTGTCTCCGGGACAGACAGCCAGGATCACCTGCTCAGGAGATGTACTGGCAAAAAAATATGCTCGGTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATTTATAAAGACAGTGAGCGGCCCTCAGGGATCCCTGAGCGATTCTCCGGCTCCAGCTCAGGGACCACAGTCACCTTGACCATCAGCGGGGCCCAGGTTGAGGATGAGGCTGACTATTACTGTTACTCTGCGGCTGACAACAATCTCACAGTGACACAGGCAGATGGAGAAATGAGACACAAACCTCCTATGAGCTGACACAGCCATCCTCA...GTGTCAGTGTCTCCGGGACAGACAGCCAGGATCACCTGCTCAGGAGATGTACTGGCA..................AAAAAATATGCTCGGTGGTTCCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATTTATAAAGAC.....................AGTGAGCGGCCCTCAGGGATCCCT...GAGCGATTCTCCGGCTCCAGC......TCAGGGACCACAGTCACCTTGACCATCAGCGGGGCCCAGGTTGAGGATGAGGCTGACTATTACTGTTACTCTGCGGCTGACAACAATCT200483146189199275292344352461484522
IGLV3-9*01IGLV3-9*011IGLVGenomic Only1Homo sapiensATGGCCTGGACCGCTCTCCTTCTGAGCCTCCTTGCTCACTTTACAGGTGCTGCCCCCAGTGTCCCAGCCACCTACCCAGCTCCAAGGCTCTGGGTCCAGCCTGGCCTGACAGTGATCTCAGCAGGGCCCTGCCTGTGGTGTGCAGGATGCTCATGATCCTGCTGCAGGGGGAGGGGCTGCTGGAGGTGAAATCCCCCCACACTGTTCTTCTGTGCTCATGGTCCCCTGAGGACACTTCTATTCCTGAAACTCAGGCCAGGCAGGTGGGAAGGCATTGTTGGGTTGAGCCTCTCAGTTTCAAGTCTATTCTATTCTCTCCCCTTTTCTTGCAGGTTCTGTGGCCTCCTATGAGCTGACTCAGCCACTCTCAGTGTCAGTGGCCCTGGGACAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGAAGTAAAAATGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCATCTATAGGGATAGCAACCGGCCCTCTGGGATCCCTGAGCGATTCTCTGGCTCCAACTCGGGGAACACGGCCACCCTGACCATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGCAGCACTGCACACAGTAACACAGGCAGATGAAGAAGTGAGACACAAACCTCCTATGAGCTGACTCAGCCACTCTCA...GTGTCAGTGGCCCTGGGACAGACGGCCAGGATTACCTGTGGGGGAAACAACATTGGA..................AGTAAAAATGTGCACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTCATCTATAGGGAT.....................AGCAACCGGCCCTCTGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......TCGGGGAACACGGCCACCCTGACCATCAGCAGAGCCCAAGCCGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGCAGCACTGCA344628146333343419436488496605629667
IGLV4-3*01IGLV4-3*011IGLVGenomic Only1Homo sapiensATGGCCTGGGTCTCCTTCTACCTACTGCCCTTCATTTTCTCCACAGGTCAGAACATCCCAGGGAATTCAGGGAAATGTTTTCACTGCTATTTTCCCATGAGCACCAGTCCTCAGGGGCATTCTTTCCAGTTCTTCTGTGCATTCAGCATCATTCATGACATTCTGTTTACAGGTCTCTGTGCTCTGCCTGTGCTGACTCAGCCCCCGTCTGCATCTGCCTTGCTGGGAGCCTCGATCAAGCTCACCTGCACCCTAAGCAGTGAGCACAGCACCTACACCATCGAATGGTATCAACAGAGACCAGGGAGGTCCCCCCAGTATATAATGAAGGTTAAGAGTGATGGCAGCCACAGCAAGGGGGACGGGATCCCCGATCGCTTCATGGGCTCCAGTTCTGGGGCTGACCGCTACCTCACCTTCTCCAACCTCCAGTCTGACGATGAGGCTGAGTATCACTGTGGAGAGAGCCACACGATTGATGGCCAAGTCGGTTGAGCCACAGTGACACAGATGAAGGGGAAGTGAGGCCAAAACCCTGCCTGTGCTGACTCAGCCCCCGTCT...GCATCTGCCTTGCTGGGAGCCTCGATCAAGCTCACCTGCACCCTAAGCAGTGAGCACAGC...............ACCTACACCATCGAATGGTATCAACAGAGACCAGGGAGGTCCCCCCAGTATATAATGAAGGTTAAGAGTGAT.........GGCAGCCACAGCAAGGGGGACGGGATCCCC...GATCGCTTCATGGGCTCCAGT......TCTGGGGCTGACCGCTACCTCACCTTCTCCAACCTCCAGTCTGACGATGAGGCTGAGTATCACTGTGGAGAGAGCCACACGATTGATGGCCAAGTCGGTTGAGC184497146173183259279331351460498535
IGLV4-60*02IGLV4-60*021IGLVGenomic Only1Homo sapiensATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAGGTCAGGAGGACCCTCAGCATCCTCATGCCCCAGCTCACTGACACCATCTCCCAAACTCATACCAGAAATGTTGTTTGCTCTTGTCCTTCCTTCAGGCCATAATGAGCGTCTCTGTTTTCAGGGTCTCTCTCCCAGCCTGTGCTGACTCAATCATCCTCTGCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGTAGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGTGGAAGCTACAACAAGGGGAGCGGAGTTCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGACCGCTACCTCACCATCTCCAACCTCCAGTTTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCACACAGTGATACAGGCAGATGAGGAAGTGGGACAAAATCCCAGCCTGTGCTGACTCAATCATCCTCT...GCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGT...............AGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGT.........GGAAGCTACAACAAGGGGAGCGGAGTTCCT...GATCGCTTCTCAGGCTCCAGC......TCTGGGGCTGACCGCTACCTCACCATCTCCAACCTCCAGTTTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCA185483152174184260280332352461484522
IGLV4-60*03_c259t1IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAGGTCAGGAGGACCCTCAGCATCCTCATGCCCCAGCTCACTGACACCATCTCCCAAACTCATACCAGAAATGTTGTTTGCTCTTGTCCTTCCTTCAGGCCATAATGAGCGTCTCTGTTTTCAGGGTCTCTCTCCCAGCCTGTGCTGACTCAATCATCCTCTGCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGTAGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGTGGAAGCTACAACAAGGGGAGCGGAGTTCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGACTGCTACCTCACCATCTCCAACCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCACACAGTGATACAGGCAGATGAGGAAGTGGGACAAAATCCCAGCCTGTGCTGACTCAATCATCCTCT...GCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGT...............AGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGT.........GGAAGCTACAACAAGGGGAGCGGAGTTCCT...GATCGCTTCTCAGGCTCCAGC......TCTGGGGCTGACTGCTACCTCACCATCTCCAACCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCA1854831521741842602803323524614845221
IGLV4-69*01IGLV4-69*011IGLVGenomic Only1Homo sapiensATGGCTTGGACCCCACTCCTCTTCCTCACCCTCCTCCTCCACTGCACAGGTCAGGATGGCCCTCAGCACCCTGACCTCCAGCTCACTGATACCACCTCCCAAACTTATGCCAGGAATGTCCTTCCCTCTTTTCTTGACTCCAGCCGGTAATGGGTGTCTGTGTTTTCAGGGTCTCTCTCCCAGCTTGTGCTGACTCAATCGCCCTCTGCCTCTGCCTCCCTGGGAGCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGCAGCTACGCCATCGCATGGCATCAGCAGCAGCCAGAGAAGGGCCCTCGGTACTTGATGAAGCTTAACAGTGATGGCAGCCACAGCAAGGGGGACGGGATCCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTCACACAGTGACACAGGCAGATGAGGAAGTGGGACAGAAACCCAGCTTGTGCTGACTCAATCGCCCTCT...GCCTCTGCCTCCCTGGGAGCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGC...............AGCTACGCCATCGCATGGCATCAGCAGCAGCCAGAGAAGGGCCCTCGGTACTTGATGAAGCTTAACAGTGAT.........GGCAGCCACAGCAAGGGGGACGGGATCCCT...GATCGCTTCTCAGGCTCCAGC......TCTGGGGCTGAGCGCTACCTCACCATCTCCAGCCTCCAGTCTGAGGATGAGGCTGACTATTACTGTCAGACCTGGGGCACTGGCATTCA181479149170180256276328348457480518
IGLV5-37*01IGLV5-37*011IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTTCTTCTCTTGCTCCTCTCTCACTGCACAGGTAGGGACAGGCCTCAGAGATCAGGGCCAGCCACCCAACCTGATTCTGGCTCTTCTGGTAAAGATCCCTGAAAAACCTCACCCTGAACCCTGCCCATCAACCATGAGTGTCTGTGTTTGCAGGTTCCCTCTCCCAGCCTGTGCTGACTCAGCCACCTTCCTCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTTGGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGACTCAGATAAGGGCCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCAGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGCCTGTGCTGACTCAGCCACCTTCC...TCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTT.........GGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGAC.........TCAGATAAGGGCCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCAGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCT180491146169179255281333353468492530
IGLV5-39*01IGLV5-39*011IGLVGenomic Only1Homo sapiensCAGCCTGTGCTGACTCAGCCAACCTCCCTCTCAGCATCTCCTGGAGCATCAGCCAGATTCACCTGCACCTTGCGCAGTGGCATCAATGTTGGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCTTCCCCGGTATCTCCTGAGGTACAAATCAGACTCAGATAAGCAGCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCAACCAATGCAGGCCTTTTACTCATCTCTGGGCTCCAGTCTGAAGATGAGGCTGACTATTACTGTGCCATTTGGTACAGCAGCACTTCTCAGCCTGTGCTGACTCAGCCAACCTCC...CTCTCAGCATCTCCTGGAGCATCAGCCAGATTCACCTGCACCTTGCGCAGTGGCATCAATGTT.........GGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCTTCCCCGGTATCTCCTGAGGTACAAATCAGAC.........TCAGATAAGCAGCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCAACCAATGCAGGCCTTTTACTCATCTCTGGGCTCCAGTCTGAAGATGAGGCTGACTATTACTGTGCCATTTGGTACAGCAGCACTTCT131276102154174289
IGLV5-45*01IGLV5-45*011IGLVGenomic Only1Homo sapiensACTGCGGGGGTAAGAGGTTGTGTCCACCATGGCCTGGACTCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAGGTAGGAATAGACTTCAGAGACCAGGGTCAGCCACCCAGCCTGATTCTGACTCTTCTGGCAAAGATCCCTGAAAAACTTTACCCTGGTTTCTGCCTTAGCACCCATTAATGTCTGTGTTTCCAGGTTCCCTCTCGCAGGCTGTGCTGACTCAGCCGGCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGCGCAGTGGCATCAATGTTGGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGACTCAGATAAGCAGCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGGCTGTGCTGACTCAGCCGGCTTCC...CTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGCGCAGTGGCATCAATGTT.........GGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGAC.........TCAGATAAGCAGCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCT209520198208284310362382497521559
IGLV5-45*02IGLV5-45*021IGLVGenomic Only1Homo sapiensACTGTGGGGGTAAGAGGTTGTGTCCACCATGGCCTGGACTCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAGGTAGGAATAGACTTCAGAGACCAGGGTCAGCCACCCAGCCTGATTCTGACTCTTCTGGCAAAGATCCCTGAAAAACTTTACCCTGGTTTCTGCCTTAGCACCCATTAATGTCTGTGTTTCCAGGTTCCCTCTCGCAGGCTGTGCTGACTCAGCCGTCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTACGCAGTGGCATCAATGTTGGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGACTCAGATAAGCAGCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGGCTGTGCTGACTCAGCCGTCTTCC...CTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTACGCAGTGGCATCAATGTT.........GGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGAC.........TCAGATAAGCAGCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCT209520198208284310362382497521559
IGLV5-45*03IGLV5-45*031IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAGGTAGGAATAGACTTCAGAGACCAGGGTCAGCCACCCAGCCTGATTCTGACTCTTCTGGCAAAGATCCCTGAAAAACTTTACCCTGGTTTCTGCCTTAGCACCCATTAATGTCTGTGTTTCCAGGTTCCCTCTCGCAGGCTGTGCTGACTCAGCCGTCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGCGCAGTGGCATCAATGTTGGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGACTCAGATAAGCAGCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGGCTGTGCTGACTCAGCCGTCTTCC...CTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGCGCAGTGGCATCAATGTT.........GGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGAC.........TCAGATAAGCAGCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCT181492146170180256282334354469493531
IGLV5-45*04IGLV5-45*041IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAGGTAGGAATAGACTTCAGAGACCAGGGTCAGCCACCCAGCCTGATTCTGACTCTTCTGGCAAAGATCCCTGAAAAACTTTACCCTGGTTTCTGCCTTAGCACCCATTAATGTCTGTGTTTCCAGGTTCCCTCTCGCAGGCTGTGCTGACTCAGCCGTCTTCCCTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGTGCAGTGGCATCAATGTTGGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGACTCAGATAAGCAGCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGGCTGTGCTGACTCAGCCGTCTTCC...CTCTCTGCATCTCCTGGAGCATCAGCCAGTCTCACCTGCACCTTGTGCAGTGGCATCAATGTT.........GGTACCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCCAGTATCTCCTGAGGTACAAATCAGAC.........TCAGATAAGCAGCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATGCAGGGATTTTACTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGCGCTTCT181492146170180256282334354469493531
IGLV5-48*01IGLV5-48*011IGLVGenomic Only1Homo sapiensATGGCCTGGAATCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAGGTAGGAAAAGGCCTCAGAGACCAGGGTCAGCCACACAGCCTGATTCTGACTCTTGTGTCAAAGATCACTAAAAAAAATATTACCTTGGTTTCTGTCTTAAAGCCTATATATGCCTGTGTTCCAGGTTCCCTCTCGCAGCCTGTGCTGACTCAGCCAACTTCCCTCTCAGCATCTCCTGGAGCATCAGCCAGACTCACCTGCACCTTGCGCAGTGGCATCAATCTTGGTAGCTACAGGATATTCTGGTACCAGCAGAAGCCAGAGAGCCCTCCCCGGTATCTCCTGAGCTACTACTCAGACTCAAGTAAGCATCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGAGCAATGCAGGGATTTTAGTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGTGCTTCTTACAGTGACACACACAGATGGGGAAGTGGGACAAAAACTCAGCCTGTGCTGACTCAGCCAACTTCC...CTCTCAGCATCTCCTGGAGCATCAGCCAGACTCACCTGCACCTTGCGCAGTGGCATCAATCTT.........GGTAGCTACAGGATATTCTGGTACCAGCAGAAGCCAGAGAGCCCTCCCCGGTATCTCCTGAGCTACTACTCAGAC.........TCAAGTAAGCATCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGAGCAATGCAGGGATTTTAGTCATCTCTGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGTGCTTCT182493146171181257283335355470494532
IGLV5-48*02IGLV5-48*021IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTCCTTCTCCTGTTCCTCTCTCACTGCACAGGTAGGAAAAGGCCTCAGAGACCAGGGTCAGCCACACAGCCTGATTCTGACTCTCGTGTCAAAGATCACTAAAAAAAATATTACCTTGGTTTCTGCCTTAAAGCCTATAAATGCCTGTGTTTCCAGGTTCCCTCTCGCAGGCTGTGCTGACTCAGCCAACTTCCCTCTCAGCATCTCCTGGAGCATCAGCCAGACTCACCTGCACCTTGCGCAGTGGCATCAGTGTTGGTAGCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCAGGTATCTCCTGAACTACTACTCAGACTCAGATAAGCACCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGACCAATGCAGGGATTTTATTCATCTCTGGGCTCTAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGTGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACGAAAACCCAGGCTGTGCTGACTCAGCCAACTTCC...CTCTCAGCATCTCCTGGAGCATCAGCCAGACTCACCTGCACCTTGCGCAGTGGCATCAGTGTT.........GGTAGCTACAGGATATACTGGTACCAGCAGAAGCCAGGGAGTCCTCCCAGGTATCTCCTGAACTACTACTCAGAC.........TCAGATAAGCACCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGACCAATGCAGGGATTTTATTCATCTCTGGGCTCTAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCACAGCAGTGCTTCT183494146172182258284336356471495533
IGLV5-52*01IGLV5-52*011IGLVGenomic Only1Homo sapiensATGGCCTGGACTCTTCTCCTTCTCGTGCTCCTCTCTCACTGCACAGGTAGGGAAAGTCCTTATAAACTGAGTCTCAGTGTCCAACCTACACCATCCCCTGTGGCTCAGACCTACAAGAAGCTTTACCCTGGGAACTGCCTTATCACCCATGATGTCTGTGTTTTCAGGTTCCCTCTCCCAGCCTGTGCTGACTCAGCCATCTTCCCATTCTGCATCTTCTGGAGCATCAGTCAGACTCACCTGCATGCTGAGCAGTGGCTTCAGTGTTGGGGACTTCTGGATAAGGTGGTACCAACAAAAGCCAGGGAACCCTCCCCGGTATCTCCTGTACTACCACTCAGACTCCAATAAGGGCCAAGGCTCTGGAGTTCCCAGCCGCTTCTCTGGATCCAACGATGCATCAGCCAATGCAGGGATTCTGCGTATCTCTGGGCTCCAGCCTGAGGATGAGGCTGACTATTACTGTGGTACATGGCACAGCAACTCTAAGACTCACACAGTGCTCCAGACCCATGAGGAAGTAAGACAAAACCCCAGCCTGTGCTGACTCAGCCATCTTCC...CATTCTGCATCTTCTGGAGCATCAGTCAGACTCACCTGCATGCTGAGCAGTGGCTTCAGTGTT.........GGGGACTTCTGGATAAGGTGGTACCAACAAAAGCCAGGGAACCCTCCCCGGTATCTCCTGTACTACCACTCAGAC.........TCCAATAAGGGCCAAGGCTCTGGAGTTCCC...AGCCGCTTCTCTGGATCCAACGATGCATCAGCCAATGCAGGGATTCTGCGTATCTCTGGGCTCCAGCCTGAGGATGAGGCTGACTATTACTGTGGTACATGGCACAGCAACTCTAAGACTCA179495146168178254280332352467496534
IGLV6-57*01IGLV6-57*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGGTGGCTGCCTGCAAGGAATTCAGGGAGCGTTCCTGGATGTCACCTGGGCTGATGATCTGTTCCTCCTGCCTGGGAACCAGTCTTCATCTCTCCCGACTGATCTCTGTGTTGCTCTCTTCTTGCAGGTTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTTCCCCCACCACTGTGATCTATGAGGATAACCAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCACACAGTGCTCCAGACCCATGGGGAAGTGAGACAGAAACTAATTTTATGCTGACTCAGCCCCACTCT...GTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATT............GCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTTCCCCCACCACTGTGATCTATGAGGAT.....................AACCAAAGACCCTCTGGGGTCCCT...GATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCA183478146172182258281333341456479517
IGLV6-57*02IGLV6-57*021IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGGTGGCTGCCTGCAAGGAATTCAGGGAGCGTTCCTGGATGTCACCTGGGCTGATGATCTGTTCCTCCTGCCTGGGAACCAGTCTTCATCTCTCCCCACTGATCTCTGTGTTGCTCTCTTCTTGCAGGTTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACCAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCACACAGTGCTCCAGACCCATGGGGAAGTGAGACAGAAACTAATTTTATGCTGACTCAGCCCCACTCT...GTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAGCAGTGGCAGCATT............GCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGAT.....................AACCAAAGACCCTCTGGGGTCCCT...GATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCA183478146172182258281333341456479517
IGLV7-43*01IGLV7-43*011IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAGGTTAAGAGAGATTTCAAATACCAGCCTTTGGAGGGATCCTTCTGTCTGCCCTTCTAATTTCTAACATGTGTCTGTTTTTTGTTTCAGGGTCCAATTCTCAGACTGTGGTGACTCAGGAGCCCTCACTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGCTTCCAGCACTGGAGCAGTCACCAGTGGTTACTATCCAAACTGGTTCCAGCAGAAACCTGGACAAGCACCCAGGGCACTGATTTATAGTACAAGCAACAAACACTCCTGGACCCCTGCCCGGTTCTCAGGCTCCCTCCTTGGGGGCAAAGCTGCCCTGACACTGTCAGGTGTGCAGCCTGAGGACGAGGCTGAGTATTACTGCCTGCTCTACTATGGTGGTGCTCAGCACAGTGACAGACTCATAAGAGGAACCAAGACATAAACCCAGACTGTGGTGACTCAGGAGCCCTCA...CTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGCTTCCAGCACTGGAGCAGTCACC.........AGTGGTTACTATCCAAACTGGTTCCAGCAGAAACCTGGACAAGCACCCAGGGCACTGATTTATAGTACA.....................AGCAACAAACACTCCTGGACCCCT...GCCCGGTTCTCAGGCTCCCTC......CTTGGGGGCAAAGCTGCCCTGACACTGTCAGGTGTGCAGCCTGAGGACGAGGCTGAGTATTACTGCCTGCTCTACTATGGTGGTGCTCAG145438146134144220246298306415439477
IGLV7-46*02IGLV7-46*021IGLVGenomic Only1Homo sapiensATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAGGTTAAGAGAGATTTCAAATACCAGCCTTTGGAGGGATCCCTTTTTCTCCCTTTCTAATTCCTAATATATGTCTGTTTTTTTTGTTTCAGGGTCCAATTCCCAGGCTGTGGTGACTCAGGAGCCCTCACTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACCAGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACAAGCAACAAACACTCCTGGACACCTGCCCGGTTCTCAGGCTCCCTCCTTGGGGGCAAAGCTGCCCTGACCCTTTTGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGGCACAGTGACAGACCCATGAGAGGAACCAAGACATAAACCCAGGCTGTGGTGACTCAGGAGCCCTCA...CTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACC.........AGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACA.....................AGCAACAAACACTCCTGGACACCT...GCCCGGTTCTCAGGCTCCCTC......CTTGGGGGCAAAGCTGCCCTGACCCTTTTGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGG147440146136146222248300308417441479
IGLV8-61*01IGLV8-61*011IGLVGenomic Only1Homo sapiensATGGCCCGGATTCCTCTCTCCTTCATCCTCCTCAGTCATCAAAGAGATTCCATTAGGGGGCAATCAAAGGATGCTGGGGCCTGCTACTAGCTCCCAAAAAACACCACAAGCATTTCAGCAGGGAGAAAAGAAAATGCTCACAAGGATGGGGTTAGATTTAGTTATAAACCAGATTGTGTGGCAGGAGGGAGGACATATCCCCCATCCTTTGGCCACTCCAAAATTGGGAGAGCTAATCTGGGGAAAGGCACCAACACCTATTCATTAGTGTCTCGGTCCTGTGTGATCATGGGTCTGTGTGAGTTCTCAGCAGCTGCCTCTCTCAAGGTCTCCCCACAGGACAGCAGGGTGAAACCTGGGGCAGGAAGAGAGGGGAAGCTGATTTGCATAAAGAACTTTTTTTATCCTATTGGGTCTGGGGAGGCATGAAAAGGCCCTGAGGAAAACAAACCCCAGCTGGGAAGCCTGAGAACACTTAGCCTTCATGAGTGTCCCCACCATGGCCTGGATGATGCTTCTCCTCGGACTCCTTGCTTATGGATCAGGTCAGGGGAAGGGACTCTATCCCTGGGGGACCACAGAAAACAGGGTCCAGGTTACTCTCATCCTCATGATCATAACTGTGTCTCTCCTGTTCGTTTTAGGAGTGGATTCTCAGACTGTGGTGACCCAGGAGCCATCGTTCTCAGTGTCCCCTGGAGGGACAGTCACACTCACTTGTGGCTTGAGCTCTGGCTCAGTCTCTACTAGTTACTACCCCAGCTGGTACCAGCAGACCCCAGGCCAGGCTCCACGCACGCTCATCTACAGCACAAACACTCGCTCTTCTGGGGTCCCTGATCGCTTCTCTGGCTCCATCCTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTGATTATTACTGTGTGCTGTATATGGGTAGTGGCATTTCCACAGTGATTTAAACCTATGAGGAAGTGCAACTAAAACCCAGACTGTGGTGACCCAGGAGCCATCG...TTCTCAGTGTCCCCTGGAGGGACAGTCACACTCACTTGTGGCTTGAGCTCTGGCTCAGTCTCT.........ACTAGTTACTACCCCAGCTGGTACCAGCAGACCCCAGGCCAGGCTCCACGCACGCTCATCTACAGCACA.....................AACACTCGCTCTTCTGGGGTCCCT...GATCGCTTCTCTGGCTCCATC......CTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTGATTATTACTGTGTGCTGTATATGGGTAGTGGCATTTC656951134645655731757809817926952990
IGLV9-49*01IGLV9-49*011IGLVGenomic Only1Homo sapiensATGGCCTGGGCTCCTCTGCTCCTCACCCTCCTCAGTCTCCTCACAGGTCAGGGTGGGCAGTGGGCTGGGCCCCCAAAGGGACCCCCACCTCCCAGCCTCCATCTCCCCATCCCTGCTCTTCCTCCTCCAACAGCTCATCAGCCACCCACCAACAGGAGCCCTCATGGGTGTCTGTGTTTCCAGGGTCCCTCTCCCAGCCTGTGCTGACTCAGCCACCTTCTGCATCAGCCTCCCTGGGAGCCTCGGTCACACTCACCTGCACCCTGAGCAGCGGCTACAGTAATTATAAAGTGGACTGGTACCAGCAGAGACCAGGGAAGGGCCCCCGGTTTGTGATGCGAGTGGGCACTGGTGGGATTGTGGGATCCAAGGGGGATGGCATCCCTGATCGCTTCTCAGTCTTGGGCTCAGGCCTGAATCGGTACCTGACCATCAAGAACATCCAGGAAGAGGATGAGAGTGACTACCACTGTGGGGCAGACCATGGCAGTGGGAGCAACTTCGTGTAACCCACAGTGACACAGGCAGAGGGGAAGTGAGACAAAAACCCAGCCTGTGCTGACTCAGCCACCTTCT...GCATCAGCCTCCCTGGGAGCCTCGGTCACACTCACCTGCACCCTGAGCAGCGGCTACAGT...............AATTATAAAGTGGACTGGTACCAGCAGAGACCAGGGAAGGGCCCCCGGTTTGTGATGCGAGTGGGCACTGGT......GGGATTGTGGGATCCAAGGGGGATGGCATCCCT...GATCGCTTCTCAGTCTTGGGC......TCAGGCCTGAATCGGTACCTGACCATCAAGAACATCCAGGAAGAGGATGAGAGTGACTACCACTGTGGGGCAGACCATGGCAGTGGGAGCAACTTCGTGTAACC195511146184194270290342365474512549
IGLV2-14*01IGLV2-14*011IGLVUnrearranged and Rearranged1Homo sapiensnoneATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGTGACGCCTCCAGGGAAGGGGCTTCAGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAATCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTC1754711461641742502763283364454725101
IGLV2-8*03IGLV2-8*032IGLVGenomic and rearranged1Homo sapiensnoneCAGTCTGCCCTGACTCAGCCTCCCTCCGCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAAGCGGCCCTCAGGGGTCCCTGATCGCTTCTTTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCGTCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTTCCAGTCTGCCCTGACTCAGCCTCCCTCC...GCGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAAGCGGCCCTCAGGGGTCCCT...GATCGCTTCTTTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCGTCTCTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCAGCTCATATGCAGGCAGCAACAATTTC1297761021541622701
IGKJ2*04IGKJ2*042IGKJUnrearranged and Rearranged1Homo sapiensnoneAGTTTTTGTATAGGAGGGAAGTTAAGAGGAACCATTGTGTGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAACTGTGCAGTTTTGGCCAGGGGACCAAGCTGGAGATCAAAC40781392
IGHD3-10*03IGHD3-10*031IGHDGenomic Only1Homo sapiensnoneGGTTTGGGGTGAGGTCTGTGTCACTGTGGTATTACTATGGTTCAGGGAGTTATTATAACCACAGTGTCACAGAGTCCATCAAAAACCGTATTACTATGGTTCAGGGAGTTATTATAAC295960871281
IGHD3-16*03IGHD3-16*031IGHDGenomic Only1Homo sapiensnoneGGTTTGAAGTGAGGTCTGTGTCACTGTGGTATTATGATTACATTTGGGGGAGTTATCGTTATACCCACAGCATCACACGGTCCATCAGAAACCGTATTATGATTACATTTGGGGGAGTTATCGTTATACC296566931281
IGHD5-18*02IGHD5-18*021IGHDGenomic Only1Homo sapiensGTGAATATAGTGGCTACGATTACGTGAATATAGTGGCTACGATTAC123
IGHV1-69*05IGHV1-69*051IGHVGenomic Only1Homo sapiensnoneCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCACGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGATCTCCTACAATTGTGACGAGAGACAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCACGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA129676991511742892973191
IGHV1-69*13IGHV1-69*131IGHVGenomic Only1Homo sapiensATGGACTGGACCTGGAGGGTCCTCTTTGTGGTGGCAGCTACAGGTGTCCAGTCCCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGACAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA553504454130153205228343351373
IGHV1-69*15IGHV1-69*151IGHVGenomic Only1Homo sapiensGTTCCTCTTTGTGGTGGCAGCAGCTACAGGTAAGGGGCTTCCTAGTCCTAAGGCTGAGGAAGGGATCCTGGTTTAGTTAAAGAGGATTTTATTCACCCCTGTGTCCTGTCCACAGGTGTCCAGTTCCAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTCAGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATCTTTGGTACAGCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACCAGGTCCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTTCTGGAGGCACCTTC............AGCAGCTATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAAGGATCATCCCTATC......TTTGGTACAGCAAACTACGCACAGAAGTTCCAG...GGCAGAGTCACGATTACCGCGGACGAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGAGA127422116126202225277300415423451
IGHV2-26*02IGHV2-26*021IGHVGenomic Only1Homo sapiensTCCTCTGGGTTCAAAAGCCGAGCACGGGGCCTCGCTCAGTGACTCCTGTGCCCCACCATGGACACGCTTTGCTACACACTCCTGCTGCTGACCACCCCTTCCTGTGAGTGCTGTGGTCAGGGACTTCCTCAGAAGCGAAACATCAGTTGTCTCCTTTGTGGGCTTCATCTCCTTATGTCTTCTCCACAGGGGTCTTGTCCCAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACGAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATACCACAGAGACACAGCCCAGGATGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGC......AATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAAT.........GACGAAAAATCCTACAGCACATCTCTGAAG...AGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCACGGATAC201501190200276305357377492502540
IGHV2-26*04IGHV2-26*041IGHVGenomic Only1Homo sapiensATGGACACGCTTTGCTACACACTCCTGCTGCTGACCACCCCTTCCTGTGAGTGCTGTGGTCAGGGACTTCCTCAGAAGTGAAACATCAGTTGTCTCCTTTGTGGGCTTCATCTCCTTATGTCTTCTCCACAGGGGTCTTGTCCCAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGCAATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAATGACGAAAAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATACCACAGAGACACAGCCCAGGATGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCTCTGGGTTCTCACTCAGC......AATGCTAGAATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATTTTTTCGAAT.........GACGAAAAATCCTACAGCACATCTCTGAAG...AGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAATATGGACCCTGTGGACACAGCCACATATTACTGTGCATGGATAC144444146133143219248300320435445483
IGHV2-70*04IGHV2-70*041IGHVGenomic Only1Homo sapiensTCTCCTGGGTTCAAAAGACGAGGACAGGGCCTCGCTCAGTGAATCCTGCTCTCCACCATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCTTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGACACAGCCCAGGGCGCCTCCTGTACAAGAACCCAGGTCACCTTGAAGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGCGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGAT.........GATGATAAATTCTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC201501190200276305357377492502540
IGHV2-70*05IGHV2-70*051IGHVGenomic Only1Homo sapiensATGGACATACTTTGTTCCACGCTCCTGCTACTGACTGTCCCGTCCTGTGAGTGCTGTGGTCAGGTAGTACTTCAGAAGCAAAAAATCTATTCTCTCCTTTGTGGGCTTCATCTTCGTATGTCTTCTCCACAGGGGTCTTATCCCAGGTCACCTTGAAGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGCACTAGTGGAATGCGTGCGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGATGATGATAAATTCTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATACCACAGAGACACAGCCCAGGGCGCCTCCTGTACAACAGGTCACCTTGAAGGAGTCTGGTCCT...GCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCTCTGGGTTCTCACTCAGC......ACTAGTGGAATGCGTGCGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACGCATTGATTGGGAT.........GATGATAAATTCTACAGCACATCTCTGAAG...ACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACACAGCCACGTATTACTGTGCACGGATAC144444146133143219248300320435445478
IGHV3-16*03IGHV3-16*031IGHVGenomic Only1Homo sapiensATGGAATTTGGGCTGAGCTGGGTTTTTCTTGCTGGTATTTTAAAAGGTGATTCATGGAGAAATAAGGATATTGAGTGAGTGGACATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGCCTGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGTGGACTCCGTGAAGCGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAATCCTGTGAGGGGACACAAGTGCGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGCCTGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGTGGACTCCGTGAAG...CGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAA159454146148158234257309332447455493
IGHV3-16*04IGHV3-16*041IGHVGenomic Only1Homo sapiensATGGAATTTGGGCTGAGCTGGGTTTTTCTTGCTGGTATTTTAAAAGGTGATTCATGGAGAACTAAGGATATTGAGTGAGTGGACATGAGTGAGAGAAACAGTGGATATGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGATACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTGAAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGTGGACTCCGTGAAGCGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAATCCTGTGAGGGGACACAAGTGCGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGATACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTGAAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGTGGACTCCGTGAAG...CGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGAAA159454146148158234257309332447455493
IGHV3-20*02IGHV3-20*021IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAGGTGATTCATGGATCAATAGAGATGTTGAGTGTGAGTGAACACGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTTTGCAGCCTCTGGATTCACCTTTGATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAATGGTGGTAGCACAGGTTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGAGACACAGTGAGGGGAAGCCAGTGAGAGCCCAGACACAAACGGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTTTGCAGCCTCTGGATTCACCTTT............GATGATTATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATTAATTGGAAT......GGTGGTAGCACAGGTTATGCAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGAGA161456146150160236259311334449457495
IGHV3-21*03IGHV3-21*031IGHVGenomic Only1Homo sapiensTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGTAGTAGTTACATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACAGCTGTGTATTACTGTGCGAGAGACACAGTGAGGGGAGGTCATTGCTCGCGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATTAGTAGTAGT......AGTAGTTACATATACTACGCAGACTCAGTGAAG...GGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACAGCTGTGTATTACTGTGCGAGAGA22317112197120172195310318346
IGHV3-23*03IGHV3-23*031IGHVGenomic Only1Homo sapiensGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGTGGTAGTAGCACATACTATGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGATAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGAGAGGTGCAGCTGTTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............AGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATTTATAGCGGT......GGTAGTAGCACATACTATGCAGACTCCGTGAAG...GGCCGGTTCACCATCTCCAGAGATAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAAGA12967699151174289
IGHV3-25*03IGHV3-25*031IGHVGenomic Only1Homo sapiensATGGAGTTTGTGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAACGTGATCTATAGAGAACTAGAGATATTGAGTATGAATGGATATGAGTGAGAAACAGTGGATACGTGTGGCAGTTTCTGACCGGGGTGTCTCTGTGTTTGCAGGTATCCAGTGTGAGATGCAGCTGGTGGAGTCTGGGGGAGGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTCAGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAATGGGGGTAGCACATACCTCATAGACTCCGGTAAGGACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTGTATTAGTGTACCAGAGACACAGTGAGGGGAGGTCAGTGTGAGCCCAGACACAAACCGAGATGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTC............AGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAAT......GGGGGTAGCACATACCTCATAGACTCCGGTAAG...GACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTGTATTAGTGTACCAGAGA159454146148158234257309332447455493
IGHV3-25*05IGHV3-25*051IGHVGenomic Only1Homo sapiensTCGCGAGTTGTTTGCAGGTGTCCAGTGTGAGATGCAGCTGGTGGAGTCTGGGGGAGGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTCAGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAATGGGGGTAGCACATACCTCATAGACTCCGGTAAGGACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTCTATTAGTGTACCAGAGACACAGTGAGGGGAGGTCATTGGAGATGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGCAAAGCCTGCGTGGTCCCCGAGACTCTCCTGTGCAGCCTCTCAATTCACCTTC............AGTAGCTACTACATGAACTGTGTCCGCCAGGCTCCAGGGAATGGGCTGGAGTTGGTTGGACAAGTTAATCCTAAT......GGGGGTAGCACATACCTCATAGACTCCGGTAAG...GACCGATTCAATACCTCCAGAGATAACGCCAAGAACACACTTCATCTGCAAATGAACAGCCTGAAAACCGAGGACACGGCCCTCTATTAGTGTACCAGAGA293241828104127179202317325353
IGHV3-33*06IGHV3-33*061IGHVGenomic Only1Homo sapiensTTGTTTGCAGGTGTCCAGTGTCAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAAAGACACAGTGAGGGGAGGTCAGTGCTCGCGACAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTC............AGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGAT......GGAAGTAATAAATACTATGCAGACTCCGTGAAG...GGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAAAGA22317112197120172195310318346
IGHV3-35*02IGHV3-35*021IGHVGenomic Only1Homo sapiensATGGAATTTGGGCTGAGCTGGGTTTTTCTTGCTGCTATTTTAAAAGGTGATTCATGAAGAACTAAGGATATTGAGTGAGTGGACATGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCAGGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACAGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAATGGCAGTAGGACGCACTATGCAGACTCTGTGAAGGGCCAATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCGAGGACACGGCTGTGTATTACTGTGTGAGAAACACTGTGAGAGGACGGAAGTGTGAGCCCAGACACAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAACAGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTTAGTTGGAAT......GGCAGTAGGACGCACTATGCAGACTCTGTGAAG...GGCCAATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCGAGGACACGGCTGTGTATTACTGTGTGAGAAA159454146148158234257309332447455493
IGHV3-62*03IGHV3-62*031IGHVGenomic Only1Homo sapiensATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAGAGGTGATTCATAGATAAATAGAGATGTTGAGTGGGAGTGGACATGAGTGAGAGAAACAGTGGATGTGTGTGGCAGTTTCTGACCTTGGTGTCTTTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTCTGCTATGCACTGGGTCCGCCAGGCTCCAAGAAAGGGTTTGTAGTGGGTCTCAGTTATTAGTACAAGTGGTGATACCGTACTCTACACAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCCAGAATTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACATGGCTGTGTATTACTGTGTGAAAGACGCAGTGAGAAGTCAGTGTGAGCCCAGACACAAACCTCGAGGTGCAGCTGGTGGAGTCTGGGGAA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTCTGCTATGCACTGGGTCCGCCAGGCTCCAAGAAAGGGTTTGTAGTGGGTCTCAGTTATTAGTACAAGT......GGTGATACCGTACTCTACACAGACTCTGTGAAG...GGCCGATTCACCATCTCCAGAGACAATGCCCAGAATTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGACGACATGGCTGTGTATTACTGTGTGAAAGA161456146150160236259311334449457494
IGHV3-64*07IGHV3-64*071IGHVGenomic Only1Homo sapiensnoneATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTTAAAGGTGATTCATGAGGAAATAGAGATATTGAGTGTGAGTGGACATGAGTGAGAGAAACAGTGGATTTGTGTGGCAGTTTCTGACCTTGGTGTCTCTGTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAATGGGGGTAGCACATATTATGCAGACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGACACAGTGAGGAGAAGTTAATGTGGGACCATGCAGAAACCGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATTAGTAGTAAT......GGGGGTAGCACATATTATGCAGACTCTGTGAAG...GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGAGA1614561461501602362593113344494574991
IGHV4-28*02IGHV4-28*021IGHVGenomic Only1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGAGCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGTGGGAGCATCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGT.........GGGAGCATCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAA140435146129139215241293313428436474
IGHV4-28*05IGHV4-28*051IGHVGenomic Only1Homo sapiensTCGCGAGGGCTCACTGTGGGTTTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGTGGGAGCATCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAACACAGTGAGGGGAGGTGAGTGTGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGT.........GGGAGCATCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAA473423646122148200220335343371
IGHV4-28*07IGHV4-28*071IGHVGenomic Only1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGAGCCCAGGGCTCACTGTGGGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTACAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGCAGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAACACAGTGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTACAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCTCTGGTTACTCCATCAGC.........AGTAGTAACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATCTATTATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGAAA140435146129139215241293313428436474
IGHV4-30-2*05IGHV4-30-2*051IGHVGenomic Only1Homo sapiensGGCTCACTGTGGGTTTCTCTGTTCACAGGGGTCCTGTCCCAGCTGCAGCTGCAGGAGTCCGGCTCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGACACAATGAGGGGAGGTGAGTGTGAGCTCGCGACAGCTGCAGCTGCAGGAGTCCGGCTCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTCCTGGAGCTGGATCCGGCAGCCACCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATCATAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGA403382939115144196216331339370
IGHV4-30-4*09IGHV4-30-4*091IGHVGenomic Only1Homo sapiensATGAAACACCTGTGGTTCTTCCTCCTGCTGGTGGCAGCTCCCAGATGTGAGTGTCTCAAGGCTGCAGACATGGAGATATGGGAGGTGCCTCTGATCCCAGGGCTCACTGTGTGTCTCTCTGTTCACAGGGGTCCTGTCCCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACACAATGAGGGGAGGTGAGTGTGAGCCCAGACACAAACCCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGA140438146129139215244296316431439477
IGHV4-4*01IGHV4-4*011IGHVGenomic Only1Homo sapiensTCGCGAGGGCTCACTGTGTGTTTCTCTGTTCACAGGGGTCCTGTCTCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTCCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTGCTGTGCGAGAGACACAGTGAGGGGAGGTGAGTGTGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTCCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC.........AGTAGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGT.........GGGAGCACCAACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTGCTGTGCGAGAGA473423646122148200220335343371
IGHV5-51*07IGHV5-51*071IGHVGenomic Only1Homo sapiensATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAGGTCAGTCCTGCCGAGGGCTTGAGGTCACAGAGGAGAACGGGTGGAAAGGAGCCCCTGATTCAAATTTTGTGTCTCCCCCACAGGAGTCTGTGCCGAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCACCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACACACAGTGAGAGAAACCAGCCCCGAGCCCGTCTAAAACCGAGGTGCAGCTGGTGCAGTCTGGAGCA...GAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCGGCTGGGTGCACCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGT......GACTCTGATACCAGATACAGCCCGTCCTTCCAA...GGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACA141436146130140216239291314429437474
IGHV6-1*03IGHV6-1*031IGHVGenomic Only1Homo sapiensATGTCTGTCTCCTTCCTCATCTTCCTGCCCGTGCTGGGCCTCCCATGGGGTCAGTGTCAGGGAGATGCCGTATTCACAGCAGCATTCACAGACTGAGGGGTGTTTCACTTTGCTGTTTCCTTTTGTCTCCAGGTGTCCTGTCACAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCTCCGGGGACAGTGTCTCTAGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCCAAGTGGTATAATGATTATGCAGTATCTGTGAAAAGTTGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAAGAGACACAGTGAGGGGAAGTCAGTGTGAGCCCAGACACAAACCCAGGTACAGCTGCAGCAGTCAGGTCCA...GGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCTCCGGGGACAGTGTCTCT......AGCAACAGTGCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACATACTACAGGTCC...AAGTGGTATAATGATTATGCAGTATCTGTGAAA...AGTTGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAAGAGA144448149133143219248300326441449487
IGHV8-51-1*02IGHV8-51-1*021IGHVGenomic Only1Homo sapiensTAAGATTTATCTCCTTTTTTGTTTCTCCTTCTGTCTATATTCTCTCTGTCTCTCTCTTCCTCCCTCTTTCTCTCTCTCTCTCCATCTCTCTCTCTCTGTCTCTCTCTCACACACAAATACACACACATGCAATCGTTGACAGTATATAGGCTAATTAAGAATATATTCCCATATGATTTAAAAATAACAGTTTTACAAATATTTGCCTTTAATTTTTCAAAGAAAATTAAATCCAAATGCCAGTGATTTTTTATGTGACTTTTAAAATTTAAATTGTTAATTTTTGTTTTCATCAATGCTTGTATGTGTGCTTTTGTATTCTTTCAGATTATTTGGTGCCTTCACAGAATTAAACATGTGAAACTCTCCACTTGAATTTCTGTGACTCAGGACTGGTGAGCAAAAAGTTAGAAGTCACTCTCCTGATCCTTCCCTACAGCTGCAGATTCCTGAAGGTAATGACCTCACAGTAGACCAAGGCCCTCAAAGGTGACCTTGAGTTCCAGCACATCTTGGGAGGCCAAGCGGATGTTTGTGAAAGAAATAGTGGCTATGTGACAGTTTCTAACCAGAATATCTCTGTGTTTTCAGGTATCCAGGGTGAGGCCCAGCTTACAGAGTCTGGGGGAGACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTCAGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGTGAAAGTCATCAATACAATGCAGACTATGTTAGGGGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGATCAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAACATCGTGATGGGAAGTCCACGTGGGCTCAGAGACAGACTGAGGCCCAGCTTACAGAGTCTGGGGGA...GACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTC............AGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGT......GAAAGTCATCAATACAATGCAGACTATGTTAGG...GGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGATCAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAA603898148592602678701753776891899937
IGHV8-51-1*03IGHV8-51-1*031IGHVGenomic Only1Homo sapiensCTTGAGTTCCAGCACATCTTGGGAGGCCAAGCGGATGTTTGTGAAAGAAATAGTGGCTATGTGACAGTTTCTAACCAGAATATCTCTGTGTTTTCAGGTATCCAGGGTGAGGCCCAGCTTACAGAGTCTGGGGGAGACTTGGTACACTGAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTCAGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGTGAAAGTCATCAATACAATGCAGACTATGTTAGGGGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAACATCGTGATGGGAAGTCCACGTGGGCTCAGAGACAGACTGAGGCCCAGCTTACAGAGTCTGGGGGA...GACTTGGTACACTGAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTC............AGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGT......GAAAGTCATCAATACAATGCAGACTATGTTAGG...GGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAA10940415298108184207259282397405443
IGHV8-51-1*04IGHV8-51-1*041IGHVGenomic Only1Homo sapiensATGAAAACAGGGCCCAAGCTGGAGAACGGGTTTCCTGTCACCCTCACGTTTCACCGTTAGATACTCTACACTATGCCTATGCTGAGGTGTGTGTTTAATATAATTAGAAAATGGTATTTATATACGTGTATAATCATATCTAGTGTAAGAATTTGTAGTTTCCACCTTATGTGACCATTAAAGACAACATCTCTCACGTTATTCAAGGACCTTATAAAGTATAATACTTTTACATAAGATTTATCTCCTTTTTTGTGTTTCTCCTTCTGTCTATATTCTCTCTGTCTCTCTCTTCCTCCCTCTTTCTCTCTCTCTCTCCATCTCTCTCTCTCTGTCTCTCTCTCACACACAAATACACACACATGCAATCGTTGACAGTATATAGGCTAATTAAGAATATATTCCCATATGATTTAAAAATAACAGTTTTACAAATATTTGCCTTTAATTTTTCAAAGAAAATTAAATCCAAATGCCAGTGATTTTTTATGTGACTTTTAAAATTTAAATTGTTAATTTTTGTTTTCATCAATGCTTGTATGTGTGCTTTTGTATTCTTTCAGATTATTTGGTGCCTTCACAGAATTAAACATGTGAAACTCTCCACTTGAATTTCTGTGACTCAGGACTGGTGAGCAAAAAGTTAGAAGTCACTCTCCTGATCCTTCCCTACAGCTGCAGATTCCTGAAGGTAATGACCTCACAGTAGACCAAGGCCCTCAAAGGTGACCTTGAGTTTCCAGCACATCTTGGGAGGCCAAGCGGATGTTTGTGAAAGAAATAGTGGCTATGTGACAGTTTCTAACCAGAATATCTCTGTGTTTTCAGGTATCCAGGGTGAGGCCCAGCTTACAGAGTCTGGGGGAGACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTCAGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGTGAAAGTCATCAATACAATGCAGACTATGTTAGGGGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAACATCGTGATGGGAAGTCCACGTGGGCTCAGAGACAGACTGAGGCCCAGCTTACAGAGTCTGGGGGA...GACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTC............AGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGT......GAAAGTCATCAATACAATGCAGACTATGTTAGG...GGCAGACTCACCACTTCCAGAGACAACACCAAGTACATGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAA84011351558298399159389901013112811361174
IGHV8-51-1*05IGHV8-51-1*051IGHVGenomic Only1Homo sapiensCTTGAGTTCCAGCACATCTTGGGAGGCCAAGCGGATGTTTGTGAAAGAAATAGTGGCTATGTGACAGTTTCTAACCAGAATATCTCTGTGTTTTCAGGTATCCAGGGTGAGGCCCAGCTTACAGAGTCTGGGGGAGACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTCAGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGTGAAAGTCATCAATACAATGCAGACTATGTTAGGGGCAGACTCACCACTTCCAGAGACAACACCAAGTACGTGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAACATCGTGATGGGAAGTCCACGTGGGCTCAGAGACAGACTGAGGCCCAGCTTACAGAGTCTGGGGGA...GACTTGGTACACTTAGAGGGGCCCCTGAGGCTCTCCTGTGCAGCCTCTTGGTTCACCTTC............AGTATCTATGAGATTCACTGGGTTTGCCAGGCCTCAGGGAAGGGGCTGGAATGGGTTGCAGTTATATGGCGTGGT......GAAAGTCATCAATACAATGCAGACTATGTTAGG...GGCAGACTCACCACTTCCAGAGACAACACCAAGTACGTGCTGTACATGCAAATGAACAGCCTGAGAACCCAGAACATGGCAGCATTTAACTGTGCAGGAAA10940415298108184207259282397405443
IGHD2-21*01IGHD2-21*012IGHDGenomic and rearranged1Homo sapiensnoneGGATTTTGTGGGGGCTCGTGTCACTGTGAGCATATTGTGGTGGTGATTGCTATTCCCACAGTGACACAACCCCATTCCTAAAGCAGCATATTGTGGTGGTGATTGCTATTCC295657841281
IGHD2-8*02IGHD2-8*022IGHDGenomic and rearranged1Homo sapiensnoneGGATTTTGTGGGGGCTCGTGTCACTGTGAGGATATTGTACTGGTGGTGTATGCTATACCCACAGTGACACAGCCCCATTCCCAAAGCAGGATATTGTACTGGTGGTGTATGCTATACC295960871281
IGHV4-30-4*i024IGHVGenomic and rearranged1Homo sapiensnoneCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTGGTTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAGCAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC......AGTGGTGGTTACTACTGGAGTTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGTACATCTATTACAGT.........GGGAGCACCTACTACAACCCGTCCCTCAAG...AGTCGAGTTACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCAGACACGGCCGTGTATTACTGTGCCAGAG.1298761051571772921
IGHV4-4*10IGHV4-4*104IGHV4-4*i03IGHVGenomic Only1Homo sapiensnoneCAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGCAGTGGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGTGGGAGCACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGACAGGTGCAGCTGCAGGAGTCGGGCCCA...GGACTGGTGAAGCCTTCGGGGACCCTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCATCAGC.........AGTGGTAACTGGTGGAGTTGGGTCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATCTATCATAGT.........GGGAGCACCAACTACAACCCGTCCCTCAAG...AGTCGAGTCACCATATCAGTAGACAAGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAG.1295761021541742891
IGHV5-51*06IGHV5-51*066IGHV5-51*i01IGHVGenomic Only1Homo sapiensnoneGAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCGGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTTACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGAGAGGTGCAGCTGGTGCAGTCTGGAGCA...GAGGTGAAAAAGCCGGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGT......GACTCTGATACCAGATACAGCCCGTCCTTCCAA...GGCCAGGTTACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGA..129476991511742891
IGHV3-30-42*01IGHV3-30-42*011IGHVGenomic and rearranged1Homo sapiensnoneATGGGGTGTGAATTAAGCTGAATTTTTCTTGTTGGTATTTTAAAAGGTAACTCATAGGGAACTAGAGTGAGTGAGAGTGAGTGGATATGAGTGAGAGAAACAGTGGATATGTTTGCCAGTTTCTGACCAGGATTTGTTTGTATTTTCAGGTGTTCAGTGTGAGGTGGAGCTGATAGAGCCCACAGAGGACCTGAGACAACCTGGGAAGTTCCTGAGACTCTCCTGTGTAGCCTCTAGATTCGCCTTCAGTAGCTTCTGAATGAGCCCAGTTCACCAGTCTGCAGGCAAGGGGCTGGAGTGAGTAATAGATATAAAAGATGATGGAAGTCAGATACACCATGCAGACTCTGTGAAGGGCAGATTCTCCATCTCCAAAGACAATGCTAAGAACTCTCTGTATCTGCAAATGAACAGTCAGAGAACTGAGGACATGGCTGTGTATGGCTGTACATAAGGTTCCAAGTGAGGAAACATCGGTGTGAGTCCAGACACAAAATGAGGTGGAGCTGATAGAGCCCACAGAG...GACCTGAGACAACCTGGGAAGTTCCTGAGACTCTCCTGTGTAGCCTCTAGATTCGCCTTC............AGTAGCTTCTGAATGAGCCCAGTTCACCAGTCTGCAGGCAAGGGGCTGGAGTGAGTAATAGATATAAAAGATGAT......GGAAGTCAGATACACCATGCAGACTCTGTGAAG...GGCAGATTCTCCATCTCCAAAGACAATGCTAAGAACTCTCTGTATCTGCAAATGAACAGTCAGAGAACTGAGGACATGGCTGTGTATGGCTGTACATAAGGTT1614581481501602362593113344494594971
IGHV3-13*06IGHV3-13*063IGHV3-13*i01IGHVRearranged Only1Homo sapiensnoneGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTC............AGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCT.........GGTGACACATACTATCCAGGCTCCGTGAAG...GGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAGA129376991511712861
IGHV3-43D*05IGHV3-43D*053IGHV3-43D*i02IGHVRearranged Only1Homo sapiensnoneGAAATGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGATGGTGGTAGCACATACTATGCAGACTCTGTGAAGGGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGATAGAAATGCAGCTGGTGGAGTCTGGGGGA...GTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTT............GATGATTATGCCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATTAGTTGGGAT......GGTGGTAGCACATACTATGCAGACTCTGTGAAG...GGTCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACCGCCTTGTATTACTGTGCAAAAGATA129876991511742891
IGLV1-36*01_c330g2IGLVGenomic Only1Homo sapiensnoneATGGCCTGGTCCCCTCTCTTCCTCACCCTCATCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAGAGAGGCCCTGGGAAGCCCATGCGACCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCGGTGTCTGAAGCCCCCAGGCAGAGGGTCACCATCTCCTGTTCTGGAAGCAGCTCCAACATCGGAAATAATGCTGTAAACTGGTACCAGCAGCTCCCAGGAAAGGCTCCCAAACTCCTCATCTATTATGATGATCTGCTGCCCTCAGGGGTCTCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGGCTGAATGGTCCCACAGTGCTCCAGGCCCAGGGGGAACAGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCG...GTGTCTGAAGCCCCCAGGCAGAGGGTCACCATCTCCTGTTCTGGAAGCAGCTCCAACATC............GGAAATAATGCTGTAAACTGGTACCAGCAGCTCCCAGGAAAGGCTCCCAAACTCCTCATCTATTATGAT.....................GATCTGCTGCCCTCAGGGGTCTCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGGCTGAATGGTCC1734681461621722482713233314404695071
IGLV1-47*01IGLV1-47*012IGLVGenomic Only1Homo sapiensnoneATGGCCGGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGTGACAGGATGGGGACCAAGAGAGGGGCCCTGGGAAGCCCATGGGGCCCTGCTTTCTCCTCTTGTCTCCTTTTGTCTCTTGTCAATCACCATGTCTGTGTCTCTCTCACTTCCAGGGTCCTGGGCCCAGTCTGTGCTGACTCAGCCACCCTCAGCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATCGGAAGTAATTATGTATACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGGAATAATCAGCGGCCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCCCACAGTGCTCCAGGCCCAGGGGGAACTGAGACAAGAACCCAGTCTGTGCTGACTCAGCCACCCTCA...GCGTCTGGGACCCCCGGGCAGAGGGTCACCATCTCTTGTTCTGGAAGCAGCTCCAACATC............GGAAGTAATTATGTATACTGGTACCAGCAGCTCCCAGGAACGGCCCCCAAACTCCTCATCTATAGGAAT.....................AATCAGCGGCCCTCAGGGGTCCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACCTCAGCCTCCCTGGCCATCAGTGGGCTCCGGTCCGAGGATGAGGCTGATTATTACTGTGCAGCATGGGATGACAGCCTGAGTGGTCC1734681461621722482713233314404695071
IGLV1-51*02IGLV1-51*022IGLVGenomic Only1Homo sapiensnoneATGACCTGCTCCCCTCTCCTCCTCACCCTTCTCATTCACTGCACAGGTGCCCAGACACAGGGTCAGGGGAGGGGTCCAGGAAGCCCATGAGGCCCTGCTTTCTCCTTCTCTCTCTAGACCAAGAATCACCGTGTCTGTGTCTCTCCTGCTTCCAGGGTCCTGGGCCCAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGGCACAGTGCTCCAGCCCAATGGGGAACTGAGACAAGAACCCAGTCTGTGTTGACGCAGCCGCCCTCA...GTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATT............GGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATCTATGAAAAT.....................AATAAGCGACCCTCAGGGATTCCT...GACCGATTCTCTGGCTCCAAG......TCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGG1674621461561662422653173254344635011
IGLV10-54*01IGLV10-54*012IGLVGenomic Only1Homo sapiensnoneATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGGTGAGAGTGGACCTTACCCAGGGATCTGCACCCACCTCTGCTCCAGCTTCTCCACTCCCTGGCTCAGTGGACTCTGATCCTGCTCTCACATTCCTTTCTGTCCCCTCTACAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTTGGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAATAACAACCGGCCCTCAGGGATCTCAGAGAGATTATCTGCATCCAGGTCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTCACACAGTGCCTCAGGCCAGTGGGGAAGTGAGATAAAAACTCAGGCAGGGCTGACTCAGCCACCCTCG...GTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTT............GGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAAT.....................AACAACCGGCCCTCAGGGATCTCA...GAGAGATTATCTGCATCCAGG......TCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTCA1704651461591692452683203284374665041
IGLV10-54*04IGLV10-54*043IGLV10-54*i01IGLVGenomic and rearranged1Homo sapiensnoneATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGGTGAGAGTGGACCTTACCCAGGGATCTGCACCCACCTCTGCTCCAGCTTCTCCACTCCCTGGCTCAGTGGACTCTGATCCTGCTCTCACATTCCTTTCTGTCCCCTCTACAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTTGGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAATAACAACCGGCCCTCAGGGATCTCAGAGAGATTCTCTGCATCCAGGTCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTCACACAGTGCCTCAGGCCAGTGGGGAAGTGAGATAAAAACTCAGGCAGGGCTGACTCAGCCACCCTCG...GTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACAATGTT............GGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAAT.....................AACAACCGGCCCTCAGGGATCTCA...GAGAGATTCTCTGCATCCAGG......TCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCT..1704631461591692452683203284374665041
IGLV10-54*05IGLV10-54*052IGLVGenomic Only1Homo sapiensnoneATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAGGTGAGAGTGGACCTTACCCAGGGATCTGCACCCACCTCTGCTCCAGCTTCTCCACTCCCTGGCTCAGTGGACTCTGATCCTGCTCTCACATTCCTTTCTGTCCCCTCTACAGTGTCAGTGGTCCAGGCAGGGCTGACTCAGCCACCCTCGGTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACATTGTTGGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAATAACAACCGGCCCTCAGGGATCTCAGAGAGATTCTCTGCATCCAGGTCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTCACACAGTGCCTCAGGCCAGTGGGGAAGTGAGATAAAAACTCAGGCAGGGCTGACTCAGCCACCCTCG...GTGTCCAAGGGCTTGAGACAGACCGCCACACTCACCTGCACTGGGAACAGCAACATTGTT............GGCAACCAAGGAGCAGCTTGGCTGCAGCAGCACCAGGGCCACCCTCCCAAACTCCTATCCTACAGGAAT.....................AACAACCGGCCCTCAGGGATCTCA...GAGAGATTCTCTGCATCCAGG......TCAGGAAACACAGCCTCCCTGACCATTACTGGACTCCAGCCTGAGGACGAGGCTGACTATTACTGCTCAGCATGGGACAGCAGCCTCAGTGCTCA1704651461591692452683203284374665041
IGLV2-14*01_g168t_t198g_c337t2IGLVGenomic Only1Homo sapiensnoneATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAGGTGATGCCTCCAGGGAAGGGGCTTCGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTC.....................AGTAAGCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTTC1754711461641742502763283364454725101
IGLV2-14*03IGLV2-14*033IGLV2-14*i01IGLVGenomic and rearranged1Homo sapiensnoneATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAGGTGATGCCTCCAGGGAAGGGGCTTCGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCAGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTCTCCACAGTGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTC.....................AGTAATCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTC..1754691461641742502763283364454725101
IGLV2-18*02IGLV2-18*022IGLVGenomic Only1Homo sapiensnoneATGGCCTGGGCTCTGCTCCTCCTCACCCTCCTCACTCAGGGCACAGGTGAGGCCTCCAGGGAAGGGGCTTCGGGGACCTCTGGGCTGATCCTTAACTCCTGCTCCTCAGGCTCACCTGGGCCCAGCACTGACTTACTAAAATGTGTTTCTTCCTTTTTCCAGGATCCTGGGCTCAGTCTGCCCTGACTCAGCCTCCCTCCGTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTAGTTATAACCGTGTCTCCTGGTACCAGCAGCCCCCAGGCACAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTCCCTGATCGCTTCTCTGGGTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTTCCACAGAGGTCCAAGTTCCTGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTCCCTCC...GTGTCCGGGTCTCCTGGACAGTCAGTCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGT.........AGTTATAACCGTGTCTCCTGGTACCAGCAGCCCCCAGGCACAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAATCGGCCCTCAGGGGTCCCT...GATCGCTTCTCTGGGTCCAAG......TCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTTC1744701461631732492753273354444715091
IGLV2-23*02IGLV2-23*022IGLVGenomic Only1Homo sapiensnoneATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGACACAGGTGACGCCTCCAGGGAAGGGGTCTTGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGGAGTTATAACCTTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTCCACAGTGGTCCAAGTTCATGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGG.........AGTTATAACCTTGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTC.....................AGTAAGCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTC1754711461641742502763283364454725101
IGLV2-23*04IGLV2-23*042IGLVGenomic Only1Homo sapiensnoneATGGCCTGGGCTCTGCTGCTCCTCAACCTCCTCACTCAGGACACAGGTGACACCTCCAGGGAAGGGGTCTTGGGGACCTCTGGGCTGATCCTTGGTCTCCTGCTCCTCAGGCTCACCGGGGCCCAGCACTGACTCACTGGCATGTGTTTCTCCCTCTTTCCAGGGTCCTGGGCCCAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACAATCTCTGGACTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTCCACAGTGGTCCAAGTTCATGGGGAACTGAGACCAAAACCCAGTCTGCCCTGACTCAGCCTGCCTCC...GTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGATGTTGGT.........GGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTC.....................AGTAAGCGGCCCTCAGGGGTTTCT...AATCGCTTCTCTGGCTCCAAG......TCTGGCAACACGGCCTCCCTGACAATCTCTGGACTCCAGGCTGAGGACGAGGCTGATTATTACTGCTGCTCATATGCAGGTAGTAGCACTTTC1754711461641742502763283364454725101
IGLV3-12*01IGLV3-12*012IGLVGenomic Only1Homo sapiensnoneACGGCCTGGACCCCTCTCCTCCTCGGCCTCCTCGCTCACTGCACAGGTGCTCTGCCCAGGGTATCACCAACCTGCCCATCCCCAGGGCTCTGGGTCCAGTGTGGCCATGACTATGAGCTCAGGAGGGCCCTGCCTGTGGTGGGCAGGATGCTCATGACCCTGCTGCAGGGTGAGGGGCTGGCAGAGCTGAAGTCCCCTCAAACTCTGCTCAGAGGCTTGTGAGAGCCTGAGGGGCTGCACCTGCCAGGAGAGAGTACTGGGTTTTCAGTTCAAAGGCTCCATGCAGAGGGAAAGTCCATGGGCCACTGGGGCTAGGGCTGATTGCAGGGGATACCCTGAGGGTTCACAGACTCTCTGAAGCTTTTCCAGGACAGCAGGGCAGGGGATTTCATACGGATCTTTTACCTAAAAGCCATCCTCTCCTTTTTTTTTTTTTTTAATCTTTGCAGGCTCTGCGACCTCCTATGAGCTGACTCAGCCACACTCAGTGTCAGTGGCCACAGCACAGATGGCCAGGATCACCTGTGGGGGAAACAACATTGGAAGTAAAGCTGTGCACTGGTACCAGCAAAAGCCAGGCCAGGACCCTGTGCTGGTCATCTATAGCGATAGCAACCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACCCAGGGAACACCACCACCCTAACCATCAGCAGGATCGAGGCTGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGTAGTAGTGATCATCCCACGGTGACACAGGCAGATGGGGAAGTGAGACAAAAACATCCTATGAGCTGACTCAGCCACACTCA...GTGTCAGTGGCCACAGCACAGATGGCCAGGATCACCTGTGGGGGAAACAACATTGGA..................AGTAAAGCTGTGCACTGGTACCAGCAAAAGCCAGGCCAGGACCCTGTGCTGGTCATCTATAGCGAT.....................AGCAACCGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAAC......CCAGGGAACACCACCACCCTAACCATCAGCAGGATCGAGGCTGGGGATGAGGCTGACTATTACTGTCAGGTGTGGGACAGTAGTAGTGATCATCC4617501464504605365536056137227517891
IGLV3-16*01_t145g_t146c2IGLVGenomic Only1Homo sapiensnoneATGGCCTGGATCCCTCTCCTGCTCCCCCTCCTCACTCTCTGCACAGGTGCTGACCCCAGGCCCTTCCCCAGGCTCAGTCCCCACAGATTCCAAGTTGAGCCTGACCTGAATCCTGAGCAAAGCCCAGACACAGCCTCTGGGTGGGACTCCTGGAAATGGGTCCTTTGTCTTCAAGCCCCCTCTCTTGTTCTTCCTTGCAGGCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCTAGGACAGATGGCCAGGATCACCTGCTCTGGAGAAGCATTGCCAAAAAAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGCGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAATAGTCACATTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCTATCAGCAGACAGCAGTGGTACTTATCCCACAGTGACACAAGGAGACAGGGAAGTGAAACATAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCTAGGACAGATGGCCAGGATCACCTGCTCTGGAGAAGCATTGCCA..................AAAAAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGAC.....................AGCGAGAGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAGC......TCAGGGACAATAGTCACATTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCTATCAGCAGACAGCAGTGGTACTTATCC2125011462012112873043563644735025401
IGLV3-19*02IGLV3-19*022IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACCCCTCTCTGGCTTACTCTCCTCACTCTTTGCATAGGTGCTGCCTCCCAGGGCTCAACCCCATATTATCATGCTAGCTGTGCCAACCTGGCCCTGAGCTTCGGCTCAACACAGGGAGTAGTGTAGGGTGTGGGACTCTAGGCGTGAAACCCTTATCCTCACCTCTTCTGTCCTCTTTTGCAGGTTCTGTGGTTTCGTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACGTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCTGGGACAGCAGTGGTAACCATCCCACAGTGACACAGACAGATGGGGAAGTGAGACAGAAACCTCGTCTGAGCTGACTCAGGACCCTGCT...GTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGA..................AGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACGTGTCATCTATGGTAAA.....................AACAACCGGCCCTCAGGGATCCCA...GACCGATTCTCTGGCTCCAGC......TCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCTGGGACAGCAGTGGTAACCATCC2044931461932032792963483564654945321
IGLV3-22*03IGLV3-22*032IGLVGenomic Only1Homo sapiensnoneATGGCATGGGCCACACTCCTGCTCCCACTCCTCAACCTCTACACAGGTGCTGCCCCCAGACCCTGCCCCAGGCTCAGCCCTCCTAAGCCCCTGGTCTTACCTTGAACCCTGAGCTCAGCCCAGGCACAGCCTCAGGGCGACACCACTGGAATGGGTTTGTTATCTTCAAGCCCCCTCTCTTGTCCTCTCTTGCAGGCTCTGTTGCCTCCTATGAGCTGACACAGCTACCCTCGGTGTCATTGTCCCCAGGACAGAAAGCCAGGATCACCTGCTCTGGAGATGTACTGGGGAAAAATTATGCTGACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGAGTTGGTGATATACGAAGATAGTGAGCGGTACCCTGGAATCCCTGAACGATTCTCTGGGTCCACCTCAGGGAACACGACCACCCTGACCATCAGCAGGGTCCTGACCGAAGACGAGGCTGACTATTACTGTTTGTCTGGGAATGAGGATAATCCCTCAGTGACACAGGCAGATGGGGAAGTGAGACACAAACTTCCTATGAGCTGACACAGCTACCCTCG...GTGTCATTGTCCCCAGGACAGAAAGCCAGGATCACCTGCTCTGGAGATGTACTGGGG..................AAAAATTATGCTGACTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGAGTTGGTGATATACGAAGAT.....................AGTGAGCGGTACCCTGGAATCCCT...GAACGATTCTCTGGGTCCACC......TCAGGGAACACGACCACCCTGACCATCAGCAGGGTCCTGACCGAAGACGAGGCTGACTATTACTGTTTGTCTGGGAATGAGGATAATCC2074901461962062822993513594684915291
IGLV3-25*03_g74c2IGLVGenomic Only1Homo sapiensnoneATGGCCTGGATCCCTCTACTTCTCCCCCTCCTCACTCTCTGCACAGGTGCTGTCCCCAGGCCCTGCTCCAGGCCCTGCTCCAGTCTTATTCCCCACAGATCCCAAGTTGAGCCTGCCCTGAATCCCGAGCAAAGCCCAGACACAGCCTCTGGGTGCGACTCCTGGGAATGGGTCCTTTGTCTTCAAGCCCCCTCTCTTGTTCTTCCTTGCAGGCTCTGAGGCCTCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGCAGATGCATTGCCAAAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCCCACAGTGACACAAGCAGACAGGGAAGTGAGACATAAACCTCCTATGAGCTGACACAGCCACCCTCG...GTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGCAGATGCATTGCCA..................AAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGAC.....................AGTGAGAGGCCCTCAGGGATCCCT...GAGCGATTCTCTGGCTCCAGC......TCAGGGACAACAGTCACGTTGACCATCAGTGGAGTCCAGGCAGAAGACGAGGCTGACTATTACTGTCAATCAGCAGACAGCAGTGGTACTTATCC2245131462132232993163683764855145521
IGLV4-60*03IGLV4-60*032IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAGGTCAGGAGGACCCTCAGCATCCTCATGCCCCAGCTCACTGACACCATCTCCCAAACTCATACCAGAAATGTTGTTTGCTCTTGTCCTTCCTTCAGGCCATAATGAGCGTCTCTGTTTTCAGGGTCTCTCTCCCAGCCTGTGCTGACTCAATCATCCTCTGCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGTAGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGTGGAAGCTACAACAAGGGGAGCGGAGTTCCTGATCGCTTCTCAGGCTCCAGCTCTGGGGCTGACCGCTACCTCACCATCTCCAACCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCACACAGTGATACAGGCAGATGAGGAAGTGGGACAAAATCCCAGCCTGTGCTGACTCAATCATCCTCT...GCCTCTGCTTCCCTGGGATCCTCGGTCAAGCTCACCTGCACTCTGAGCAGTGGGCACAGT...............AGCTACATCATCGCATGGCATCAGCAGCAGCCAGGGAAGGCCCCTCGGTACTTGATGAAGCTTGAAGGTAGT.........GGAAGCTACAACAAGGGGAGCGGAGTTCCT...GATCGCTTCTCAGGCTCCAGC......TCTGGGGCTGACCGCTACCTCACCATCTCCAACCTCCAGTCTGAGGATGAGGCTGATTATTACTGTGAGACCTGGGACAGTAACACTCA1854831521741842602803323524614845221
IGLV5-37*02IGLV5-37*022IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACTCCTCTTCTTCTCTTGCTCCTCTCTCACTGCACAGGTAGGGACAGGCCTCAGAGATCAGGGCCAGCCACCCAACCTGATTCTGGCTCTTCTGGTAAAGATCCCTGAAAAACCTCACCCTGAACCCTGCCCATCAACCATGAGTGTCTGTGTTTGCAGGTTCCCTCTCCCAGCCTGTGCTGACTCAGCCACCTTCCTCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTTGGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGACTCAGATAAGGGCCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGCCTGTGCTGACTCAGCCACCTTCC...TCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTT.........GGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGAC.........TCAGATAAGGGCCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCGGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCT1804911461691792552813333534684925301
IGLV5-37*03IGLV5-37*032IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACTCCTCTTCTTCTCTTGCTCCTCTCTCACTGCACAGGTAGGGACAGGCCTCAGAGATCAGGGCCAGCCACCCAACCTGATTCTGGCTCTTCTGGTAAAGATCCCTGAAAAACCTCACCCTGAACCCTGCCCATCAACCATGAGTGTCTGTGTTTGCAGGTTCCCTCTCCCAGCCTGTGCTGACTCAGCCACCTTCCTCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTTAGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGACTCAGATAAGGGCCAGGGCTCTGGAGTCCCCAGCCGCTTCTCTGGATCCAAAGATGCTTCAGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCTCACAGTGACACACACAGATGGGGAAGTGGGACAAAAACCCAGCCTGTGCTGACTCAGCCACCTTCC...TCCTCCGCATCTCCTGGAGAATCCGCCAGACTCACCTGCACCTTGCCCAGTGACATCAATGTT.........AGTAGCTACAACATATACTGGTACCAGCAGAAGCCAGGGAGCCCTCCCAGGTATCTCCTGTACTACTACTCAGAC.........TCAGATAAGGGCCAGGGCTCTGGAGTCCCC...AGCCGCTTCTCTGGATCCAAAGATGCTTCAGCCAATACAGGGATTTTACTCATCTCCGGGCTCCAGTCTGAGGATGAGGCTGACTATTACTGTATGATTTGGCCAAGCAATGCTTCT1804911461691792552813333534684925301
IGLV6-57*03IGLV6-57*032IGLVGenomic Only1Homo sapiensnoneATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGGTGGCTGCCTGCAAGGAATTCAGGGAGCGTTCCTGGATGTCACCTGGGCTGATGATCTGTTCCTCCTGCCTGGGAACCAGTCTTCATCTCTCCCCACTGATCTCTGTGTTGCTCTCTTCTTGCAGGTTCTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACCAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCACACAGTGCTCCAGACCCATGGGGAAGTGAGACAGAAACTAATTTTATGCTGACTCAGCCCCACTCT...GTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATT............GCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGAT.....................AACCAAAGACCCTCTGGGGTCCCT...GATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCA1834781461721822582813333414564795171
IGLV6-57*04IGLV6-57*044IGLV6-57*i01IGLVGenomic and rearranged1Homo sapiensnoneATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAGGTGGCTGCCTGCAAGGAATTCAGGGAGCGTTCCTGGATGTCACCTGGGCTGATGATCTGTTCCTCCTGCCTGGGAACCAGTCTTCATCTCTCCCCACTGATCTCTGTGTTGCTCTCTTCTTGCAGGTTCTTGGGCCAATTTTATGCTGACTCAGCCGCACTCTGTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATTGCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGATAACCAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAATCACACAGTGCTCCAGACCCATGGGGAAGTGAGACAGAAACTAATTTTATGCTGACTCAGCCGCACTCT...GTGTCGGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCAGCATT............GCCAGCAACTATGTGCAGTGGTACCAGCAGCGCCCGGGCAGTGCCCCCACCACTGTGATCTATGAGGAT.....................AACCAAAGACCCTCTGGGGTCCCT...GATCGGTTCTCTGGCTCCATCGACAGCTCCTCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGTCTTATGATAGCAGCAAT..1834761461721822582813333414564795171
IGLV7-46*01IGLV7-46*012IGLVGenomic Only1Homo sapiensnoneATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAGGTTAAGAGAGATTTCAAATACCAGCCTTTGGAGGGATCCCTTTTTCTCCCTTTCTAATTCCTAATATATGTCTGTTTTTTTTGTTTCAGGGTCCAATTCCCAGGCTGTGGTGACTCAGGAGCCCTCACTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACCAGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACAAGCAACAAACACTCCTGGACACCTGCCCGGTTCTCAGGCTCCCTCCTTGGGGGCAAAGCTGCCCTGACCCTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGGCACAGTGACAGACCCATGAGAGGAACCAAGACATAAACCCAGGCTGTGGTGACTCAGGAGCCCTCA...CTGACTGTGTCCCCAGGAGGGACAGTCACTCTCACCTGTGGCTCCAGCACTGGAGCTGTCACC.........AGTGGTCATTATCCCTACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGACACTGATTTATGATACA.....................AGCAACAAACACTCCTGGACACCT...GCCCGGTTCTCAGGCTCCCTC......CTTGGGGGCAAAGCTGCCCTGACCCTTTCGGGTGCGCAGCCTGAGGATGAGGCTGAGTATTACTGCTTGCTCTCCTATAGTGGTGCTCGG1474401461361462222483003084174414791
IGLV8-61*02IGLV8-61*022IGLVGenomic Only1Homo sapiensnoneATGGCCTGGATGATGCTTCTCCTCGGACTCCTTGCTTATGGATCAGGTCAGGGGAAGGGACTCTATCCCTGGGGGACCACAGAAAACAGGGTCCAGGTTACTCTCATCCTCATGATCATAACTGTGTCTCTCCTGTTCGTTTTAGGAGTGGATTCTCAGACTGTGGTGACCCAGGAGCCATCGTTCTCAGTGTCCCCTGGAGGGACAGTCACACTCACTTGTGGCTTGAGCTCTGGCTCAGTCTCTACTAGTTACTACCCCAGCTGGTACCAGCAGACCCCAGGCCAGGCTCCACGCACGCTCATCTACAGCACAAACACTCGCTCTTCTGGGGTCCCTGATTGCTTCTCTGGCTCCATCCTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTGATTATTACTGTGTGCTGTATATGGGTAGTGGCATTTCCACAGTGATTTAAACCTATGAGGAAGTGCAACTAAAACCCAGACTGTGGTGACCCAGGAGCCATCG...TTCTCAGTGTCCCCTGGAGGGACAGTCACACTCACTTGTGGCTTGAGCTCTGGCTCAGTCTCT.........ACTAGTTACTACCCCAGCTGGTACCAGCAGACCCCAGGCCAGGCTCCACGCACGCTCATCTACAGCACA.....................AACACTCGCTCTTCTGGGGTCCCT...GATTGCTTCTCTGGCTCCATC......CTTGGGAACAAAGCTGCCCTCACCATCACGGGGGCCCAGGCAGATGATGAATCTGATTATTACTGTGTGCTGTATATGGGTAGTGGCATTTC1574521461461562322583103184274534911
IGHV1-2*04IGHV1-2*042IGHVGenomic and rearranged1Homo sapiensnoneATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAGGTAAGAGGCTCCCTAGTCCCAGTGATGAGAAAGAGATTGAGTCCAGTCCAGGGAGATCTCATCCACTTCTGTGTTCTCTCCACAGGAGCCCACTCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCTGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGACACAGTGTGAAAACCCACATCCTGAGGGTGTCAGAAACCCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAACCCTAAC......AGTGGTGGCACAAACTATGCACAGAAGTTTCAG...GGCTGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGA1434381461321422182412933164314394771
IGHV1-2*05IGHV1-2*052IGHVGenomic Only1Homo sapiensnoneATATCGCGAGTCTCCACAGGTGCCCATCCCAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTCACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGACGGATCAACCCTAACAGTGGTGGCACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGTCGTGTATTACTGTGCGAGAGACACAGTGTGAAAAACCACATCCTCAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATACACCTTC............ACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGACGGATCAACCCTAAC......AGTGGTGGCACAAACTATGCACAGAAGTTTCAG...GGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGACACGGTCGTGTATTACTGTGCGAGAGA303251051281802033183263541
IGHV1-58*01IGHV1-58*012IGHVGenomic and rearranged1Homo sapiensnoneATGGACTGGATTTGGAGGATCCTCTTCTTGGTGGGAGCAGCGACAGGCAAGGAGATGCCAAGTCCCAGTGATGAGGAGGGGATTGAGTCCAGTCAAGGTGGCTTTCATCCACTCCTGTGTTCTCTCCACAGGTGCCCACTCCCAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTTACTAGCTCTGCTGTGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACGCAAATGCAGCTGGTGCAGTCTGGGCCT...GAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTT............ACTAGCTCTGCTGTGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGC......AGTGGTAACACAAACTACGCACAGAAGTTCCAG...GAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGA1434381461321422182412933164313243521
IGHV1-58*02IGHV1-58*022IGHVGenomic and rearranged1Homo sapiensnoneATGGACTGGATTTGGAGGGTCCTCTTCTTGGTGGGAGCAGCGACAGGCAAGGAGATGCCAAGTCCCAGTGATGAGGAGGGGATTGAGTCCAGTCAAGGTGGCTTTCATCCACTCCTGTGTTCTCTCCACAGGTGCCCACTCCCAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTTACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGCAGTGGTAACACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGACACAGTGTGAAAACCCACATCCTGAGAGTGTCAGAAACGCAAATGCAGCTGGTGCAGTCTGGGCCT...GAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGATTCACCTTT............ACTAGCTCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATCGTCGTTGGC......AGTGGTAACACAAACTACGCACAGAAGTTCCAG...GAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCAGA1434381461321422182412933164314394771
IGHV3-49*05IGHV3-49*052IGHVGenomic and rearranged1Homo sapiensnoneTTGTTTGCAGGTGTCCAGTGTGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTTGGTGATTATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGACACAGTGAGGGGAAGTCAATGCTCGCGAGAGGTGCAGCTGGTGGAGTCTGGGGGA...GGCTTGGTAAAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTTCTGGATTCACCTTT............GGTGATTATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATTAGAAGCAAAGCTTATGGTGGGACAACAGAATACGCCGCGTCTGTGAAA...GGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGAGA223231121971201722013163243521
IGHV5-51*01IGHV5-51*012IGHVGenomic and rearranged1Homo sapiensnoneATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAGGTCAGTCCTGCCGAGGGCTTGAGGTCACAGAGGAGAACGGGTGGAAAGGAGCCCCTGATTCAAATTTTGTGTCTCCCCCACAGGAGTCTGTGCCGAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACACACAGTGAGAGAAACCAGCCCCGAGCCCGTCTAAAACCGAGGTGCAGCTGGTGCAGTCTGGAGCA...GAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTT............ACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGT......GACTCTGATACCAGATACAGCCCGTCCTTCCAA...GGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGACA1414361461301402162392913144294374741
IGKV3-15*i021IGKV3-15*01 A117GIGKVRearranged Only1Homo sapiensnoneGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTGGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC...GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AGCAGCAACTTGGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTGGTATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC...128379961481562651
IGKV3-15*i011IGHV3-15*01 G107AIGKVRearranged Only1Homo sapiensnoneGAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAACAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC...GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTT..................AACAGCAACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCA.....................TCCACCAGGGCCACTGGTATCCCA...GCCAGGTTCAGTGGCAGTGGG......TCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC...128379961481562651

Download Affirmed Sequences