Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGKV3-15*i02
IUIS Name
Alternative namesIGKV3-15*01 A117G
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
MappedFalse
Paralogs
Paralog RepFalse

Evidence

The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission IDAccession NoSubject IDGenotype NameSequence NameSequence Match
S00043 S24P1_I24_S1_ogrdb_reportIGKV3-15*01_A117G

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGKV3-15*01_a117g 3

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation

CDR1 Start79
CDR1 End96
CDR2 Start148
CDR2 End156
CDR3 Start265

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA03368
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2024-07-12
Release Notes

Publsihed

LocusIGK
Sequence TypeV
Gene Subgroup
Gene Designation
Allele Designation
Gene start1
Gene end284

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London
Ayelet PeresBar-Ilan University, Ramat-Gan, Israel

Notes

Notes are added by IARC reviewers.

Sequence IGKV3-15*01 A117G has been discussed during IARC meetings 132 and 135.

The inference was originally reported in Mikocziova et al. iScience 2021, 24, 103192 (https://doi.org/10.1016/j.isci.2021.103192).

IGKV3-15*01_A117G was inferred in VDJbase sample P1_I24_S1.
The data had been analyzed in the past (see IARC meetings 132-134). This sample’s genotype also carries IGKV3-15*01 and a substantially lower number of reads of IGKV3D-15*01 (about 8-fold). The relatively high expression of IGKV3-15*01_A117G suggests that the allele was found in the proximal and to the typically less expressed distal IGKV locus. It was supported by 510 unmutated sequences and 424 unique CDR3s in the unmutated sequence set. The allelic ratio for IGKV3-15*01_A117G / IGKV3-15*01 was 51/49. Haplotyping associated IGKV3-15*01_A117G to IGKJ2*01 while IGKV3-15*01 associated to IGKJ2*03. IGKV3D-15*01 associated to both haplotypes as defined by alleles of IGKJ2.

Now, reanalysis (March, 2024) of the data using an updated pipeline of VDJbase and employing the AIRR-C reference set has generated updated information on this inference (see enclosure), demonstrating

  • a diversity of CDR3 lengths of reads associated to IGKV3-15*01 A117G.
  • high representation of the inferred sequence in the data set (745 and 793 for IGKV3-15*01 and IGKV3-15*01 A117G, respectively). Many reads were unmutated (approx. 70%) and carried multiple different CDR3 sequences and lengths. IGKV3D-15*01 was represented in the transcriptome with an approximately 8-fold lower number of reads.
  • a predominance of the TCC triplet was found as the final three bases
  • haplotyping demonstrated the association of IGKV3-15*01 and IGKV3-15*01 A117G to IGKJ2*03 and IGKJ2*01, respectively.
    (an updated OGRDBstats report is enclosed)

The sequence is also inferred in VDJbase P1_I33_S1, P1_I43_S1, and P1_I76_S1 but no haplotyping data are available for those samples.

There is no entry in GenBank (apart from to rearranged sequences: MW718549 and MW718534) or among genomic entries in VDJbase that is identical to the full sequence of IGKV3-15*01_A117G.

>IGKV3-15*01_A117G
GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTGGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCCTCC

IARC affirms the sequence based on inference of expression data alone at Level 1 up to and including base 332 in agreement with past practice related to the process of trimming of the 3’-end during the rearrangement process. It is acknowledged that the allele most likely carries three additional bases, typically TCC at base positions 333-335. Trailing “…” of the affirmed sequence indicates IARC’s opinion that the sequence is likely to contain additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The sequence is given the name IGKV3-15*i02. For many applications, it will be important to use the full length sequence, in which case the three most likely bases at the 3’-end should be added to the affirmed sequence. Immunoglobulin loci are highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. Inference from transcriptomic data does not firmly associate an allele to a given gene. The name (with an “i” allele designation) of an inferred allele thus does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question.

Affirmed sequence:
>IGKV3-15*i02
GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAACTTGGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCACCAGGGCCACTGGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTGAAGATTTTGCAGTTTATTACTGTCAGCAGTATAATAACTGGCC…

Attachments

Attachment File Name
 24_Finale_genotyped_ogrdb_plots.pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2024-07-12 10:25:21
Version 1 published

Publsihed

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGKV3-15*i0212024-07-12