Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV4-60*03_c259t
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGLV4-60*02_c259t_t287c 1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End52
L_PART1ATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAG
L-PART2 Start174
L-PART2 End184
L_PART2GGTCTCTCTCC
v_rs_start484
v_rs_end522
V_HEPTAMERCACAGTG
V_NONAMERACAAAATCC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02931
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup4
Gene Designation60
Allele Designation03_c259t

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OL310241

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:47
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV4-60*03_c259tGenomic Only1none12023-07-10