Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV4-60*03_c259t |
IUIS Name | |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGLV4-60*02_c259t_t287c | 1 |
Un-rearranged sequence observations that support this sequence:
CDR1 Start | 260 |
CDR1 End | 280 |
CDR2 Start | 332 |
CDR2 End | 352 |
CDR3 Start | 461 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 52 |
L_PART1 | ATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAG |
L-PART2 Start | 174 |
L-PART2 End | 184 |
L_PART2 | GGTCTCTCTCC |
v_rs_start | 484 |
v_rs_end | 522 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAAATCC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02931 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 4 |
Gene Designation | 60 |
Allele Designation | 03_c259t |
Gene start | 185 |
Gene end | 483 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV4-60*03_c259t | 1 | 2023-07-10 |