Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGHV1-58*02
IUIS NameIGHV1-58*02
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
AB019438NonlocationalGenBank1073311209
HM855905NonlocationalGenBank1329

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start218
CDR1 End241
CDR2 Start293
CDR2 End316
CDR3 Start431

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGACTGGATTTGGAGGGTCCTCTTCTTGGTGGGAGCAGCGACAG
L-PART2 Start132
L-PART2 End142
L_PART2GTGCCCACTCC
v_rs_start439
v_rs_end477
V_HEPTAMERCACAGTG
V_NONAMERTCAGAAACG

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02662
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-24
Release Notes

Correct length of leader with reference to Huang, Thörnqvist and Ohlin, 2021

LocusIGH
Sequence TypeV
Gene Subgroup1
Gene Designation58
Allele Designation02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Sequence annotation is based on Genbank sample AB019438
Leader verified against Huang, Thörnqvist and Ohlin, 2021
VDJbase example haplotype: P1_I10

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:35
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-24 08:19:13
Version 2 published

Correct length of leader with reference to Huang, Thörnqvist and Ohlin, 2021

Changes from previous version

v1v2
Subgroup typenone
L-PART1 End6146
Codon Frame1
3' Extension
5' Extension
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV1-58*02IGHV1-58*02Genomic and rearranged112023-07-10
IGHV1-58*02IGHV1-58*02Genomic and rearranged1none22024-02-24