| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV1-69*18 |
| IUIS Name | IGHV1-69*18 |
| Alternative names | IGHV1-69*i02 |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Rearranged Only |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| MK471382 | Inferred | GenBank | 1 | 295 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 76 |
| CDR1 End | 99 |
| CDR2 Start | 151 |
| CDR2 End | 174 |
| CDR3 Start | 289 |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | A |
| 3' start | |
| 3' end |
| Sequence ID | A00050 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 69 |
| Allele Designation | 18 |
| Gene start | 1 |
| Gene end | 295 |
Notes are added by IARC reviewers.
| Assessed by IARC on November 18, 2019 during meeting 45 and on December 2, 2019 during meeting 46. The committee considered IGHV1-69*01_S7220 (G163A) of submission S00010 of Genotype B16, which was previously evaluated as IGHV1-69*01_S5096 of submission S00006 at Meeting 10. It was affirmed as a Level 0 sequence at that time. The sequence was seen in 8.02% of all unmutated rearrangements, with 53668 sequences including 22586 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. Three other alleles were present in the genotype, with IGHV1-69*02 also being present in the haplotype with this allele, likely a consequence of the presence of the IGHV1-69D gene in the haplotype in question. The inferred sequence includes six differences to the *02 allele. Haplotype data is supportive of the inference. There was strong support for the sequence being affirmed up to and including nucleotide 319, in line with IARC policy, as a Level 1 sequence, with one additional 3’ nucleotide being likely present in the sequence. This is indicated in IARC and OGRDB publications by one dot at the end of the sequence. It is noted that this sequences represents a 5’- and a 3’-extension of the partial allele IGHV1-69*07 already recognized by IMGT. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Andrew Collins 2019-12-12 22:50:33 | Version 1 published Submission published by IARC on Dec 13, 2019. |
| Andrew Collins 2020-01-12 01:33:00 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| Andrew Collins 2020-01-12 01:33:00 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| Andrew Collins 2020-01-12 01:33:00 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| Andrew Collins 2020-01-12 01:33:06 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| Andrew Collins 2020-01-12 01:33:06 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| Andrew Collins 2020-01-12 01:33:06 | IMGT Name updated to IGHV1-69*18 IMGT Name updated. |
| William Lees 2023-07-10 11:24:36 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| v1 | v2 | |
|---|---|---|
| Curator | William Lees | |
| Curator address | Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden | Birkbeck College, University of London, Malet Street, London |
| Sequence Name | IGHV1-69*i02 | IGHV1-69*18 |
| Alternative names | IGHV1-69*i02 | |
| Mapped | False | |
| Functionality | F | ORF |
| Species subgroup | ||
| Subgroup type | ||
| Allele Designation | i02 | 18 |
| Full Sequence | ||
| Paralog Rep | False | |
| 3' Extension | GACACGGCCGTGTATTACTGTGCGAGAG | A |
| 3' start | 292 | |
| 3' end | 319 | |
| 5' Extension | CAGGTGCAGCTGGTGCAGTCTGGGGCT...GAGGTGA | |
| 5' start | 1 | |
| 5' end | 37 | |
| curational_tags | likely_truncated | |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV1-69*i02 | IGHV1-69*18 | 1 | 2019-12-12 |
| IGHV1-69*18 | IGHV1-69*18 | 2 | 2023-07-10 |