Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV2-14*03 |
IUIS Name | IGLV2-14*03 |
Alternative names | IGLV2-14*i01 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
MK587524 | Genbank | |||
Gibson:HG01106 | Locational | GenBank | 42 | 551 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 250 |
CDR1 End | 276 |
CDR2 Start | 328 |
CDR2 End | 336 |
CDR3 Start | 445 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAG |
L-PART2 Start | 164 |
L-PART2 End | 174 |
L_PART2 | GGTCCTGGGCC |
v_rs_start | 472 |
v_rs_end | 510 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACCAAAACC |
3' Extension | TC |
3' start | 338 |
3' end | 339 |
5' start | |
5' end |
Sequence ID | A00053 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 3 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 2 |
Gene Designation | 14 |
Allele Designation | 03 |
Notes are added by IARC reviewers.
Assessed by IARC on July 7, 2020 during meeting 57. The committee considered IGLV2-14*03x (a 5’ extension of IGLV2-14*03) of submission S00028. The sequence was seen in 6.08% of all unmutated rearrangements, with 71826 sequences including 7262 perfect matches to the inferred allele. The library had been generated from PBMC that had not been sorted for naïve B cells, resulting in the presence of reads of somatically hypermutated sequences in the data set, a fact that complicates the analysis. There was abundant variation in the CDR3 regions of the aligned sequences to an extent similar to that of other lambda germline alleles of this donor. One other alleles was present in the genotype. Haplotyping could not be performed. The inferred sequence includes 23 bases added to the 5’-end of incomplete reference allele IGLV2-14*03. There was support for the sequence being affirmed up to and including nucleotide 337, in line with IARC policy not to infer bases substantially affected by trimming during the rearrangement process, as a Level 1 sequence, with two additional 3’ nucleotide being likely present in the sequence. This is indicated in IARC and OGRDB publications by two dots at the end of the sequence. A genomic sequence (MK587524) has following the inference been cloned from the genotype of the donor that confirms the inference. It also confirms that bases 338-339 that cannot be inferred with confidence of the gene are T and C, respectively. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
Andrew Collins 2020-07-30 12:57:22 | Version 1 published Submission published by IARC on July 30th 2020. |
Mats Ohlin 2021-04-29 22:30:26 | IMGT Name updated to IGLV2-14*03 IMGT Name updated. |
Mats Ohlin 2021-04-29 22:30:39 | IMGT Name updated to IGLV2-14*03 IMGT Name updated. |
Mats Ohlin 2021-04-29 22:30:57 | IMGT Name updated to IGLV2-14*03 IMGT Name updated. |
Mats Ohlin 2021-04-29 22:30:57 | IMGT Name updated to IGLV2-14*03 IMGT Name updated. |
Mats Ohlin 2021-04-29 22:30:57 | IMGT Name updated to IGLV2-14*03 IMGT Name updated. |
William Lees 2023-07-10 11:24:46 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:33:50 | Version 3 published Supporting sequence and annotation updated |
v2 | v3 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 216 | 175 |
Gene end | 510 | 469 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 205 | 164 |
L-PART2 End | 215 | 174 |
CDR1 Start | 291 | 250 |
CDR1 End | 317 | 276 |
CDR2 Start | 369 | 328 |
CDR2 End | 377 | 336 |
CDR3 Start | 486 | 445 |
v_rs_start | 513 | 472 |
v_rs_end | 551 | 510 |
Codon Frame | 1 | |
3' start | 338 | |
3' end | 339 |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV2-14*i01 | IGLV2-14*03 | 1 | 2020-07-30 |
IGLV2-14*03 | IGLV2-14*03 | 2 | 2023-07-10 |
IGLV2-14*03 | IGLV2-14*03 | 3 | 2024-02-22 |