Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGHV6-1*01 |
IUIS Name | IGHV6-1*01 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Unrearranged and Rearranged |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
AB019441 | Nonlocational | GenBank | 83485 | 83971 |
ON052091 | Nonlocational | GenBank | 262 | 738 |
GRCh38:CM000676.2 | Locational | GenBank | 939644 | 940130 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 219 |
CDR1 End | 248 |
CDR2 Start | 300 |
CDR2 End | 326 |
CDR3 Start | 441 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 49 |
L_PART1 | ATGTCTGTCTCCTTCCTCATCTTCCTGCCCGTGCTGGGCCTCCCATGGG |
L-PART2 Start | 133 |
L-PART2 End | 143 |
L_PART2 | GTGTCCTGTCA |
v_rs_start | 449 |
v_rs_end | 487 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACACAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02781 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 6 |
Gene Designation | 1 |
Allele Designation | 01 |
Gene start | 144 |
Gene end | 448 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:42 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGHV6-1*01 | IGHV6-1*01 | 1 | 2023-07-10 |