Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV6-57*04 |
IUIS Name | IGLV6-57*04 |
Alternative names | IGLV6-57*i01 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGLV6-57*03_c21g | 47 |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
MW316677 | Nonlocational | GenBank | 52 | 397 |
Gibson:HG01106 | Locational | GenBank | 1 | 517 |
CDR1 Start | 258 |
CDR1 End | 281 |
CDR2 Start | 333 |
CDR2 End | 341 |
CDR3 Start | 456 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAG |
L-PART2 Start | 172 |
L-PART2 End | 182 |
L_PART2 | GTTCTTGGGCC |
v_rs_start | 479 |
v_rs_end | 517 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAGAAACT |
3' Extension | CA |
3' start | 334 |
3' end | 335 |
5' start | |
5' end |
Sequence ID | A00059 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 4 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 6 |
Gene Designation | 57 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
At the IARC meeting on July 20th 2020, the following features of the inference in the S000028 submission were noted: The sequence was seen in 1.49% of all unmutated rearrangements, with 14,472 sequences including 1776 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV6-57*01 allele was also present in the genotype, at a somewhat lower frequency. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to be certain of the final two nucleotides of the germline sequence. The sequence, up to and including nucleotide 333, was affirmed as the Level 1 sequence, IGLV6-57*i01. Uncertainty regarding nucleotides 334-335 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
Andrew Collins 2020-08-01 13:19:38 | Version 1 published Published by the IARC on 1/8/2020. |
William Lees 2020-08-10 15:55:56 | Version 2 published Correct sequence name from IGLV-6-57*i01 |
Mats Ohlin 2021-04-29 22:32:20 | IMGT Name updated to IGLV6-57*04 IMGT Name updated. |
William Lees 2023-07-10 11:24:48 | Version 3 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:41:15 | Version 4 published Supporting sequence and annotation updated |
v3 | v4 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 63 | 183 |
Gene end | 356 | 476 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 52 | 172 |
L-PART2 End | 62 | 182 |
CDR1 Start | 138 | 258 |
CDR1 End | 161 | 281 |
CDR2 Start | 213 | 333 |
CDR2 End | 221 | 341 |
CDR3 Start | 336 | 456 |
v_rs_start | 359 | 479 |
v_rs_end | 397 | 517 |
Codon Frame | 1 | |
3' start | 334 | |
3' end | 335 |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV-6-57*i01 | 1 | 2020-08-01 | |
IGLV6-57*i01 | IGLV6-57*04 | 2 | 2020-08-10 |
IGLV6-57*04 | IGLV6-57*04 | 3 | 2023-07-10 |
IGLV6-57*04 | IGLV6-57*04 | 4 | 2024-02-22 |