Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGLV6-57*04
IUIS NameIGLV6-57*04
Alternative namesIGLV6-57*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and Rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MW316677NonlocationalGenBank52397
Gibson:HG01106LocationalGenBank1517

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start258
CDR1 End281
CDR2 Start333
CDR2 End341
CDR3 Start456

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGGCTCCACTACTTCTCACCCTCCTCGCTCACTGCACAG
L-PART2 Start172
L-PART2 End182
L_PART2GTTCTTGGGCC
v_rs_start479
v_rs_end517
V_HEPTAMERCACAGTG
V_NONAMERACAGAAACT
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' ExtensionCA
3' start334
3' end335
5' start
5' end

Additional Information

Sequence IDA00059
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version4
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup6
Gene Designation57
Allele Designation04
Gene start183
Gene end476

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

At the IARC meeting on July 20th 2020, the following features of the inference in the S000028 submission were noted:

The sequence was seen in 1.49% of all unmutated rearrangements, with 14,472 sequences including 1776 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV6-57*01 allele was also present in the genotype, at a somewhat lower frequency. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to be certain of the final two nucleotides of the germline sequence. The sequence, up to and including nucleotide 333, was affirmed as the Level 1 sequence, IGLV6-57*i01. Uncertainty regarding nucleotides 334-335 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316677

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Andrew Collins
2020-08-01 13:19:38
Version 1 published

Published by the IARC on 1/8/2020.

William Lees
2020-08-10 15:55:56
Version 2 published

Correct sequence name from IGLV-6-57*i01

Mats Ohlin
2021-04-29 22:32:20
IMGT Name updated to IGLV6-57*04

IMGT Name updated.

William Lees
2023-07-10 11:24:48
Version 3 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:41:15
Version 4 published

Supporting sequence and annotation updated

Changes from previous version

v3v4
Subgroup typenone
Full Sequence
Gene start63183
Gene end356476
L-PART1 Start1
L-PART1 End46
L-PART2 Start52172
L-PART2 End62182
CDR1 Start138258
CDR1 End161281
CDR2 Start213333
CDR2 End221341
CDR3 Start336456
v_rs_start359479
v_rs_end397517
Codon Frame1
3' start334
3' end335

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGLV-6-57*i0112020-08-01
IGLV6-57*i01IGLV6-57*0422020-08-10
IGLV6-57*04IGLV6-57*0432023-07-10
IGLV6-57*04IGLV6-57*0442024-02-22