| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGLV3-25*03 |
| IUIS Name | IGLV3-25*03 |
| Alternative names | IGLV3-25*i01 |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and Rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| AC244250 | Nonlocational | GenBank | 137506 | 138057 | ||
| MK308865 | Inferred | GenBank | 1 | 288 | ||
| Gibson:HG01106 | Locational | GenBank | 44 | 595 | ||
| GRCh38:NC_000022.11 | Locational | GenBank | 660694 | 661245 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 299 |
| CDR1 End | 316 |
| CDR2 Start | 368 |
| CDR2 End | 376 |
| CDR3 Start | 485 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGATCCCTCTACTTCTCCCCCTCCTCACTCTCTGCACAG |
| L-PART2 Start | 213 |
| L-PART2 End | 223 |
| L_PART2 | GCTCTGAGGCC |
| v_rs_start | 514 |
| v_rs_end | 552 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACATAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | CC |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00057 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 3 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 25 |
| Allele Designation | 03 |
| Gene start | 224 |
| Gene end | 511 |
Notes are added by IARC reviewers.
| This sequence was first affirmed at the IARC Meeting 57 on July 7th 2020, where it was noted: “The sequence was seen in 4.53% of all unmutated rearrangements, with 16,227 sequences including 5410 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. A second IGLV3-25 allele, IGLV3-25*02, was also present in the genotype, at a lower frequency, and the inferred allele accounted for 73% of all IGLV3-25 alignments. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to consider the final two nucleotides of the sequence. These were not part of the Genbank submission. The sequence has previously been reported as IGLV3-25*p04. The sequence, up to and including nucleotide 339, was affirmed as the Level 1 sequence, IGLV3-25*i01. It appears to represent the full length version of the previously truncated IGLV3-25*03 sequence. It was subsequently noted that since the submission of this sequence, an identical genomic sequence has been accepted by IMGT as the full length sequence IGLV3-25*03. The sequence, up to and including nucleotide 339 will be submitted to IMGT as IGLV3-25*i01 as a record of the rearrangability (and therefore likely functionality) of the sequence. “ Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Andrew Collins 2020-08-01 13:22:28 | Version 1 published Published by the IARC on 1/8/2020. |
| William Lees 2020-08-10 15:53:51 | Version 2 published Correct sequence name from *01 to *i01 |
| William Lees 2023-07-10 11:24:47 | Version 3 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| v2 | v3 | |
|---|---|---|
| Curator | William Lees | |
| Curator address | School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney Australia | Birkbeck College, University of London, Malet Street, London |
| Sequence Name | IGLV3-25*i01 | IGLV3-25*03 |
| Alternative names | IGLV3-25*i01 | |
| Mapped | True | |
| Functionality | F | ORF |
| Inference Type | Rearranged Only | Unrearranged and Rearranged |
| Species subgroup | ||
| Subgroup type | ||
| Allele Designation | i01 | 03 |
| Full Sequence | ||
| Gene start | 1 | 224 |
| Gene end | 288 | 511 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 213 | |
| L-PART2 End | 223 | |
| CDR1 Start | 76 | 299 |
| CDR1 End | 93 | 316 |
| CDR2 Start | 145 | 368 |
| CDR2 End | 153 | 376 |
| CDR3 Start | 262 | 485 |
| v_rs_start | 514 | |
| v_rs_end | 552 | |
| Paralog Rep | False | |
| Extension? | False | True |
| 3' Extension | CC | |
| 5' Extension | ||
| curational_tags | likely_full-length | |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGLV3-25*01 | IGLV3-25*03 | 1 | 2020-08-01 |
| IGLV3-25*i01 | IGLV3-25*03 | 2 | 2020-08-10 |
| IGLV3-25*03 | IGLV3-25*03 | 3 | 2023-07-10 |