Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGLV3-25*03
IUIS NameIGLV3-25*03
Alternative namesIGLV3-25*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
AC244250NonlocationalGenBank137506138057
MK308865InferredGenBank1288
Gibson:HG01106LocationalGenBank44595
GRCh38:NC_000022.11LocationalGenBank660694661245

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGATCCCTCTACTTCTCCCCCTCCTCACTCTCTGCACAG
L-PART2 Start213
L-PART2 End223
L_PART2GCTCTGAGGCC
v_rs_start514
v_rs_end552
V_HEPTAMERCACAGTG
V_NONAMERACATAAACC

Extension

3' ExtensionCC
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00057
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version3
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup3
Gene Designation25
Allele Designation03

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

This sequence was first affirmed at the IARC Meeting 57 on July 7th 2020, where it was noted:

“The sequence was seen in 4.53% of all unmutated rearrangements, with 16,227 sequences including 5410 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. A second IGLV3-25 allele, IGLV3-25*02, was also present in the genotype, at a lower frequency, and the inferred allele accounted for 73% of all IGLV3-25 alignments. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to consider the final two nucleotides of the sequence. These were not part of the Genbank submission. The sequence has previously been reported as IGLV3-25*p04. The sequence, up to and including nucleotide 339, was affirmed as the Level 1 sequence, IGLV3-25*i01. It appears to represent the full length version of the previously truncated IGLV3-25*03 sequence. It was subsequently noted that since the submission of this sequence, an identical genomic sequence has been accepted by IMGT as the full length sequence IGLV3-25*03. The sequence, up to and including nucleotide 339 will be submitted to IMGT as IGLV3-25*i01 as a record of the rearrangability (and therefore likely functionality) of the sequence. “

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample AC244250

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Andrew Collins
2020-08-01 13:22:28
Version 1 published

Published by the IARC on 1/8/2020.

William Lees
2020-08-10 15:53:51
Version 2 published

Correct sequence name from *01 to *i01

William Lees
2023-07-10 11:24:47
Version 3 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v2v3
CuratorWilliam Lees
Curator addressSchool of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney AustraliaBirkbeck College, University of London, Malet Street, London
Sequence NameIGLV3-25*i01IGLV3-25*03
Alternative namesIGLV3-25*i01
MappedTrue
FunctionalityFORF
Inference TypeRearranged OnlyGenomic and rearranged
Species subgroup
Subgroup type
Allele Designationi0103
Full Sequence
Gene start224
Gene end513
L-PART1 Start1
L-PART1 End46
L-PART2 Start213
L-PART2 End223
v_rs_start514
v_rs_end552
Paralog RepFalse
Extension?FalseTrue
3' ExtensionCC
5' Extension
curational_tagslikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV3-25*01IGLV3-25*03Rearranged Only112020-08-01
IGLV3-25*i01IGLV3-25*03Rearranged Only122020-08-10
IGLV3-25*03IGLV3-25*03IGLV3-25*i01Genomic and rearranged132023-07-10