Species | Human |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV4-60*03 |
IUIS Name | IGLV4-60*03 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
Gibson:HG01106 | Locational | GenBank | 1 | 522 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 260 |
CDR1 End | 280 |
CDR2 Start | 332 |
CDR2 End | 352 |
CDR3 Start | 461 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 52 |
L_PART1 | ATGGCCTGGACCCCACTCCTCCTCCTCTTCCCTCTCCTCCTCCACTGCACAG |
L-PART2 Start | 174 |
L-PART2 End | 184 |
L_PART2 | GGTCTCTCTCC |
v_rs_start | 484 |
v_rs_end | 522 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAAATCC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02930 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 4 |
Gene Designation | 60 |
Allele Designation | 03 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:39:05 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
L-PART1 Start | 1 | |
L-PART1 End | 52 | |
Codon Frame | 1 | |
3' Extension | ||
5' Extension |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGLV4-60*03 | IGLV4-60*03 | Genomic Only | 1 | 185 | 483 | 174 | 184 | 260 | 280 | 332 | 352 | 461 | 484 | 522 | 1 | 2023-07-10 | ||||||||||||||
IGLV4-60*03 | IGLV4-60*03 | Genomic Only | 1 | none | 185 | 483 | 1 | 52 | 174 | 184 | 260 | 280 | 332 | 352 | 461 | 484 | 522 | 1 | 2 | 2024-02-22 |