Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGLV3-21*04
IUIS NameIGLV3-21*04
Alternative namesIGLV3-21*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
MK308864InferredGenBank1288
Gibson:HG01106LocationalGenBank7311550

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAG
L-PART2 Start481
L-PART2 End491
L_PART2GCTCTGTGACC
v_rs_start782
v_rs_end820
V_HEPTAMERCACGGTG
V_NONAMERACAAAAACA

Extension

3' ExtensionCC
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00056
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup3
Gene Designation21
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally approved by IARC at Meeting 57 on July 7, 2020, where it was noted:

“The sequence was seen in 1.61% of all unmutated rearrangements, with 9,680 sequences including 1925 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. A second IGLV3-21 allele, IGLV3-21*03, was also present in the genotype, at a higher frequency, but the inferred allele still accounted for 35% of all IGLV3-21 alignments. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to consider the final two nucleotides of the sequence. These were not part of the Genbank submission. The sequence, up to and including nucleotide 339, was affirmed as the Level 1 sequence, IGLV3-21*i01. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.”

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG01106

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Andrew Collins
2020-08-01 13:21:02
Version 1 published

Published by the IARC on 1/8/2020.

William Lees
2023-07-10 11:24:47
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorWilliam Lees
Curator addressSchool of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney AustraliaBirkbeck College, University of London, Malet Street, London
Sequence NameIGLV3-21*i01IGLV3-21*04
Alternative namesIGLV3-21*i01
MappedFalse
FunctionalityFORF
Inference TypeRearranged OnlyGenomic and rearranged
Species subgroup
Subgroup type
Allele Designationi0104
Full Sequence
Gene start492
Gene end781
L-PART1 Start1
L-PART1 End46
L-PART2 Start481
L-PART2 End491
v_rs_start782
v_rs_end820
Paralog RepFalse
Extension?FalseTrue
3' ExtensionCC
5' Extension
curational_tagslikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV3-21*i01IGLV3-21*04Rearranged Only112020-08-01
IGLV3-21*04IGLV3-21*04IGLV3-21*i01Genomic and rearranged122023-07-10