Species | Human |
Species subgroup | |
Subgroup type | |
Sequence Name | IGLV3-21*04 |
IUIS Name | IGLV3-21*04 |
Alternative names | IGLV3-21*i01 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
MK308864 | Inferred | GenBank | 1 | 288 |
Gibson:HG01106 | Locational | GenBank | 731 | 1550 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 567 |
CDR1 End | 584 |
CDR2 Start | 636 |
CDR2 End | 644 |
CDR3 Start | 753 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGACCGTTCTCCTCCTCGGCCTCCTCTCTCACTGCACAG |
L-PART2 Start | 481 |
L-PART2 End | 491 |
L_PART2 | GCTCTGTGACC |
v_rs_start | 782 |
v_rs_end | 820 |
V_HEPTAMER | CACGGTG |
V_NONAMER | ACAAAAACA |
3' Extension | CC |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A00056 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 21 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
Originally approved by IARC at Meeting 57 on July 7, 2020, where it was noted: “The sequence was seen in 1.61% of all unmutated rearrangements, with 9,680 sequences including 1925 perfect alignments to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. A second IGLV3-21 allele, IGLV3-21*03, was also present in the genotype, at a higher frequency, but the inferred allele still accounted for 35% of all IGLV3-21 alignments. Haplotype data is unavailable. Plots of the final 3’ nucleotides were considered, but the variability seen made it impossible to consider the final two nucleotides of the sequence. These were not part of the Genbank submission. The sequence, up to and including nucleotide 339, was affirmed as the Level 1 sequence, IGLV3-21*i01. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.” Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
Andrew Collins 2020-08-01 13:21:02 | Version 1 published Published by the IARC on 1/8/2020. |
William Lees 2023-07-10 11:24:47 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
v1 | v2 | |
---|---|---|
Curator | William Lees | |
Curator address | School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney Australia | Birkbeck College, University of London, Malet Street, London |
Sequence Name | IGLV3-21*i01 | IGLV3-21*04 |
Alternative names | IGLV3-21*i01 | |
Mapped | False | |
Functionality | F | ORF |
Inference Type | Rearranged Only | Genomic and rearranged |
Species subgroup | ||
Subgroup type | ||
Allele Designation | i01 | 04 |
Full Sequence | ||
Gene start | 1 | 492 |
Gene end | 288 | 779 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 481 | |
L-PART2 End | 491 | |
CDR1 Start | 76 | 567 |
CDR1 End | 93 | 584 |
CDR2 Start | 145 | 636 |
CDR2 End | 153 | 644 |
CDR3 Start | 262 | 753 |
v_rs_start | 782 | |
v_rs_end | 820 | |
Paralog Rep | False | |
Extension? | False | True |
3' Extension | CC | |
5' Extension | ||
curational_tags | likely_full-length | |
Notes | changed |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGLV3-21*i01 | IGLV3-21*04 | Rearranged Only | 1 | 1 | 288 | 76 | 93 | 145 | 153 | 262 | 1 | 2020-08-01 | ||||||||||||||||||
IGLV3-21*04 | IGLV3-21*04 | IGLV3-21*i01 | Genomic and rearranged | 1 | 492 | 779 | 1 | 46 | 481 | 491 | 567 | 584 | 636 | 644 | 753 | 782 | 820 | 2 | 2023-07-10 |