Species | Human |
Species subgroup | |
Subgroup type | |
Sequence Name | IGHV3-42D*01 |
IUIS Name | IGHV3-42D*01 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 888 |
CDR1 End | 911 |
CDR2 Start | 963 |
CDR2 End | 986 |
CDR3 Start | 1101 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 48 |
L_PART1 | AAGTCCAAATGGTCTATTTTGTTTTTTATTCTGTTTACTTTTAAAGTT |
L-PART2 Start | 802 |
L-PART2 End | 812 |
L_PART2 | GTTTGCAGGCG |
v_rs_start | 1124 |
v_rs_end | 1162 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACACAAATC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02720 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 42D |
Allele Designation | 01 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:38 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGHV3-42D*01 | IGHV3-42D*01 | Genomic Only | 1 | 813 | 1123 | 1 | 48 | 802 | 812 | 888 | 911 | 963 | 986 | 1101 | 1124 | 1162 | 1 | 2023-07-10 |