Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGLV2-14*05 |
IUIS Name | IGLV2-14*05 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGLV2-14*01_t213c_t214c_a220g | 3 |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
MW316674 | Nonlocational | GenBank | 169 | 678 |
Gibson:HG01358 | Locational | GenBank | 42 | 551 |
CDR1 Start | 250 |
CDR1 End | 276 |
CDR2 Start | 328 |
CDR2 End | 336 |
CDR3 Start | 445 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAG |
L-PART2 Start | 164 |
L-PART2 End | 174 |
L_PART2 | GGTCCTGGGCC |
v_rs_start | 472 |
v_rs_end | 510 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACCAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02901 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 2 |
Gene Designation | 14 |
Allele Designation | 05 |
Gene start | 175 |
Gene end | 471 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV2-14*05 | IGLV2-14*05 | 1 | 2023-07-10 |