Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV4-61*11
IUIS NameIGHV4-61*11
Alternative namesIGHV4-61*i03
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeRearranged Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
OU596109InferredGenBank1298

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End105
CDR2 Start157
CDR2 End177
CDR3 Start292

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' ExtensionA
3' start
3' end

Additional Information

Sequence IDA00073
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation61
Allele Designation11
Gene start1
Gene end298

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

IARC meeting 63, Nov 20th, 2020:
The meeting considered the inference of the variant IGHV4-61*02_a234g, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in ten samples, including 4 P1 samples. The meeting focused on sample P1_I86_S1, in which the inferences was seen in 1.82% of all unmutated rearrangements, with 592 sequences including 519 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-61*01 was also present in the genotype, at a lower frequency (0.38% of all unmutated sequences, 116 sequences, 107 unmutated sequences). Haplotyping data showed perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 84, Oct 25th, 2021:
IGHV4-61*02_A234G was inferred in subject S82 (P1_I86_S1; ERR2567259). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The inference was supported by many sequences (613) and unmutated sequences (530) a high allelic frequency (84%), a high overall frequency in the unmutated population (2.2%) and many unique CDR3s (528) in the unmutated sequence set. The related gene set IGHV4-4, IGHV4-59 and IGHV4-61 were represented by the following inferred alleles IGHV4-4*07 (haplotyping ratio: 2:98), IGHV4-59*01 (haplotyping ratio: 36:64), IGHV4-61*01 (haplotyping ratio 100:0), and IGHV4-61*02_A234G (haplotyping ratio: 0:100). In a separate study it has been proposed that the IGHJ6*02-related haplotype in this subject was occupied by poorly expressed allele IGHV4-4*01 (DOI: 10.3389/fimmu.2020.603980). IGHV4-61*02_A234G was found to be expressed at higher frequency than the poorly expressed allele IGHV4-61*01 (528 vs 107 unique CDR3s in the unmutated sequence set). Overall expression levels, diversity and haplotyping strongly supports the inference. In addition, the upstream region of IGHV4-61*02_A234G (DOI: 10.3389/fimmu.2021.730105) in this subject is different from that of the other alleles of these three genes that are present in this subject (including the previously published upstream region of IGHV4-4*01).

It has been noted that IGHV4-61*02_A234G was also found in subject S39 (P1_I42_S1; ERR2567216) used to assess the inference of IGHV4-4*i03 (although this data set was not submitted to IARC for assessment of IGHV4-61*02_A234G). In this sample, IGHV4-61*02_A234G was supported by many sequences (476) and unmutated sequences (395), a high overall frequency in the unmutated population (2.4%) and many unique CDR3s (390) in the unmutated sequence set. No other allele named as IGHV4-61 had been inferred in this subject but IGHV4-59*08, an allele suspected to residue in gene IGHV4-61 (DOI: 10.1038/ncomms14946), was found. The allelic ratio of IGHV4-61*02_A234G in this context would be 61%. Haplotyping of this subject was possible based on an allele of IGHD3-10 (10.3389/fimmu.2019.00987) not documented by the IMGT database. In this context, the two alleles of the genotype believed to be associated to IGHV4-61, IGHV4-61*02_A234G and IGHV4-59*08, showed excellent separation (see also documentation associated to the affirmation of IGHV4-4*i03).

IARC, taking all of the collective evidence under consideration, affirms the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. Although there is nothing in the data, including haplotype assessment, that suggest that the allele does not reside in gene IGHV4-61, it must be recognised, in particular in view of the similarity of alleles linked to IGHV4-4/IGHV4-59/IGHV4-61, that IARC gene naming does not reflect an absolute position on the precise location of the allele to a specific gene. The allele is given the name IGHV4-61*i03.

>IGHV4-61*i03
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATCTATACCAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCCGTGTATTACTGTGCGAGAG.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OU596109
VDJbase example haplotype: P1_I86
The IARC states that its location is uncertain

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:51:18
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:26:17
IMGT Name updated to IGHV4-61*11

IMGT Name updated.

William Lees
2023-07-10 11:24:41
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorMats OhlinWilliam Lees
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, SwedenBirkbeck College, University of London, Malet Street, London
Sequence NameIGHV4-61*i03IGHV4-61*11
Alternative namesIGHV4-61*i03
Chromosome14
MappedFalse
FunctionalityFORF
Subgroup typenone
Allele Designationi0311
Full Sequence
Codon Frame1
Paralog RepFalse
Extension?FalseTrue
3' ExtensionA
5' Extension
curational_tagsnonelikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGHV4-61*i03IGHV4-61*1112021-11-01
IGHV4-61*11IGHV4-61*1122023-07-10