Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGHV5-51*07
IUIS NameIGHV5-51*07
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
AC279152NonlocationalGenBank1504215515

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start216
CDR1 End239
CDR2 Start291
CDR2 End314
CDR3 Start429

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAG
L-PART2 Start130
L-PART2 End140
L_PART2GAGTCTGTGCC
v_rs_start437
v_rs_end474
V_HEPTAMERCACAGTG
V_NONAMERTCTAAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02984
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-08-15
Release Notes

Sequences added following discussion at IARC meeting on 9th August 2023

LocusIGH
Sequence TypeV
Gene Subgroup5
Gene Designation51
Allele Designation07

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample AC279152. Sequence observed in data from Rodriguez et al.
2023 as reported in VDJbase (2 samples). Example subject: P25_I44.

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-08-15 12:54:49
Version 1 published

Sequences added following discussion at IARC meeting on 9th August 2023

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV5-51*07IGHV5-51*07Genomic Only112023-08-15