| Species | Homo sapiens | 
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGKV1D-43*01 | 
| IUIS Name | IGKV1D-43*01 | 
| Alternative names | |
| Affirmation Level | 1 | 
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF | 
| Inference Type | Unrearranged and Rearranged | 
| Mapped | True | 
| Paralogs | |
| Paralog Rep | False | 
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 264 | 
| CDR1 End | 281 | 
| CDR2 Start | 333 | 
| CDR2 End | 341 | 
| CDR3 Start | 450 | 
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 | 
| L-PART1 End | 49 | 
| L_PART1 | ATGAGGGTGCCCGCTCAGCGCCTGGGGCTCCTGCTGCTCTGGTTCCCAG | 
| L-PART2 Start | 175 | 
| L-PART2 End | 185 | 
| L_PART2 | GTGCCAGATGT | 
| v_rs_start | 473 | 
| v_rs_end | 500 | 
| V_HEPTAMER | CACAGTG | 
| V_NONAMER | ACAAAAACC | 
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end | 
| Sequence ID | A02824 | 
| Curator | William Lees | 
| Curator address | Birkbeck College, University of London, Malet Street, London | 
| Version | 1 | 
| Release Date | 2023-07-10 | 
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets | 
| Locus | IGK | 
| Sequence Type | V | 
| Gene Subgroup | 1D | 
| Gene Designation | 43 | 
| Allele Designation | 01 | 
| Gene start | 186 | 
| Gene end | 472 | 
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: | 
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:43 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets | 
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date | 
|---|---|---|---|
| IGKV1D-43*01 | IGKV1D-43*01 | 1 | 2023-07-10 |