Details


Species	Human
Species subgroup
Subgroup type
Sequence Name	IGHV4-61*i04
IUIS Name
Alternative names
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Rearranged Only
Mapped	True
Paralogs
Paralog Rep	False

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV4-61*01_a41g	1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
OX384050	Inferred	GenBank	1	297

CDR delineation


CDR1 Start	76
CDR1 End	105
CDR2 Start	157
CDR2 End	177
CDR3 Start	292

Extension


3' Extension	A
3' start
3' end

Additional Information


Sequence ID	A02567
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	2
Release Date	2023-07-10
Release Notes	Bulk upload of sequences for the AIRR-C Human IG germline sets
Locus	IGH
Sequence Type	V
Gene Subgroup	4
Gene Designation	61
Allele Designation	i04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


The inference of IGHV4-6101_A41G was considered at IARC meeting 116 on Feb 27th, 2023. IGHV4-6101_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-6101. IGHV4-6101_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ602 (100:0 ratio) (IGHV4-6101 shows a haplotype ratio of 7:93). Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-6101 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP. IARC affirms the sequence as IGHV4-61i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence. >IGHV4-61*i04 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG. The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample OX384050

The inference of IGHV4-61*01_A41G was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV4-61*01_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-61*01. IGHV4-61*01_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*02 (100:0 ratio) (IGHV4-61*01 shows a haplotype ratio of 7:93).

Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-61*01 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP.

IARC affirms the sequence as IGHV4-61*i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV4-61*i04
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OX384050

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2023-03-20 08:45:34	Version 1 published Published by IARC on March 20th, 2023.


William Lees 2023-07-10 11:24:42	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

	v1	v2
Curator	Mats Ohlin	William Lees
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden	Birkbeck College, University of London, Malet Street, London
Chromosome		14
Mapped		True
Functionality	F	ORF
Inference Type	Rearranged	Rearranged Only
Subgroup type	none
Full Sequence
Codon Frame	1
Paralog Rep		False
Extension?	False	True
3' Extension		A
5' Extension
curational_tags	none	likely_truncated
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Gene start	Gene end	UTR 5' Start	UTR 5' End	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	d_rs_3_prime_start	d_rs_3_prime_end	d_rs_5_prime_start	d_rs_5_prime_end	j_rs_start	j_rs_end	Codon Frame	Version	Date
IGHV4-61*i04			Rearranged	1		none	1	298							76	105	157	177	292									1	1	2023-03-20
IGHV4-61*i04			Rearranged Only	1			1	298							76	105	157	177	292										2	2023-07-10