Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGHV4-61*i04
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeRearranged Only
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
OX384050InferredGenBank1297

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start76
CDR1 End105
CDR2 Start157
CDR2 End177
CDR3 Start292

Extension

3' ExtensionA
3' start
3' end

Additional Information

Sequence IDA02567
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation61
Allele Designationi04
Gene start1
Gene end298

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

The inference of IGHV4-61*01_A41G was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV4-61*01_A41G has been inferred in one genotype (P1_I23) in VDJbase P1 data set. The genotype also carries IGHV4-61*01. IGHV4-61*01_A41G represents 0.32% of the total unmutated population. It is represented by 91 unmutated error-free sequences and 91 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*02 (100:0 ratio) (IGHV4-61*01 shows a haplotype ratio of 7:93).

Other genes carry alleles defined by IMGT, alleles that are highly similar to IGHV4-61*01 A41G. These genes include IGHV4-59 and IGHV4-4 (>97% sequence identity). In no case do these alleles carry the A41G SNP.

IARC affirms the sequence as IGHV4-61*i04 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV4-61*i04
CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAGGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTGGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATCTATTACAGTGGGAGCACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. Other similar genes have been mentioned above.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OX384050

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 08:45:34
Version 1 published

Published by IARC on March 20th, 2023.

William Lees
2023-07-10 11:24:42
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorMats OhlinWilliam Lees
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, SwedenBirkbeck College, University of London, Malet Street, London
Chromosome14
MappedTrue
FunctionalityFORF
Inference TypeRearrangedRearranged Only
Subgroup typenone
Full Sequence
Codon Frame1
Paralog RepFalse
Extension?FalseTrue
3' ExtensionA
5' Extension
curational_tagsnonelikely_truncated
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV4-61*i0412023-03-20
IGHV4-61*i0422023-07-10