Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGKV1D-33*01 |
IUIS Name | IGKV1D-33*01 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | True |
Paralogs | IGKV1-33*01 |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
X93620 | Nonlocational | GenBank | 1 | 287 |
AC245506 | Nonlocational | GenBank | 168913 | 169411 |
NG_000833 | Nonlocational | GenBank | 334281 | 334779 |
GRCh38:NC_000002.12 | Locational | GenBank | 1056717 | 1057215 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 263 |
CDR1 End | 280 |
CDR2 Start | 332 |
CDR2 End | 340 |
CDR3 Start | 449 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 49 |
L_PART1 | ATGAGGGTCCCTGCTCAGCTCCTGGGGCTCCTGCTGCTCTGGCTCTCAG |
L-PART2 Start | 174 |
L-PART2 End | 184 |
L_PART2 | GTGCCAGATGT |
v_rs_start | 472 |
v_rs_end | 499 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACATAAATC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02820 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGK |
Sequence Type | V |
Gene Subgroup | 1D |
Gene Designation | 33 |
Allele Designation | 01 |
Gene start | 185 |
Gene end | 471 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:43 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGKV1D-33*01 | IGKV1D-33*01 | 1 | 2023-07-10 |