IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV4-39*01_c66g, in the VDJbase dataset of sample P1_I90_S1. The sequence was seen in 2.74% of all unmutated rearrangements, with 1217 sequences including 1098 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (3.09% of all unmutated sequences,
1360 sequences, 1239 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18th, 2021):
IGHV4-39*01_C66G was inferred in subject S86 (VDJbase: P1_I90_S1), a genotype that also carries IGHV4-39*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV4-39*01_C66G was well expressed, represented by 1305 sequences, 1135 unmutated sequences, 1131 unique CDR3s in the unmutated sequence set, showed an allelic frequency of 48%, and represented 3.3% of all unmutated reads of the genotype. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*01_C66G: 2:98; IGHV4-39*01: 100:0). IARC affirms the sequence as a level 1 sequence up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carries one additional base, typically A at base position 320. A trailing “.” indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. It is known that the second last base of alleles of IGHV4-39 may be either C or G. The data describing the final bases of this inferred allele strongly supports that this base (319) is a C. The inference of IGHV4-39*07_C288A in data set VDJbase: P1_I29_S1 in contrast suggests that this allele features a G as the penultimate residue, illustrating that the inference process can pick up a difference at the second last base of alleles. The allele representing IGHV4-39*01_C66G is given the name IGHV4-39*i01.

>IGHV4-39*i01
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACGTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGAC.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OU596110
VDJbase example haplotype: P1_I90 (*01_c66g)
VDJbase example haplotype: P1_I90 (*01_c66g)
Mapped by P1_I90 haplotype