| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGHV3-7*04 |
| IUIS Name | IGHV3-7*04 |
| Alternative names | IGHV3-7*i01 |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged and Rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.
'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.
| Submission ID | Accession No | Subject ID | Genotype Name | Sequence Name | Sequence Match |
|---|---|---|---|---|---|
| S00028 | MN244239 | A007 | A007 VH | IGHV3-7*02_A318G |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 236 |
| CDR1 End | 259 |
| CDR2 Start | 311 |
| CDR2 End | 334 |
| CDR3 Start | 449 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAG |
| L-PART2 Start | 150 |
| L-PART2 End | 160 |
| L_PART2 | GTGTCCAGTGT |
| v_rs_start | 457 |
| v_rs_end | 495 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACACAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | A |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A00006 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 5 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 7 |
| Allele Designation | 04 |
| Gene start | 161 |
| Gene end | 455 |
Notes are added by IARC reviewers.
| Originally assessed by IARC on May 11, 2018. “The sequence is present at a moderate frequency (0.5%), in the IgDiscover analysis. No information was provided by the submitter regarding analysis with partis or TIgGER. Haplotype analysis could not be performed. Analysis for chimerism did not provide evidence against the existence of the sequence. It has been noted that neither partis not TIgGER had been able to infer IGHV3-7*02 or any variant thereof while these tools inferred IGHV3-7*01 (see supplementary information privided with the submission ). (April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. (August 7th 2019) At the 40th meeting of the IARC, the committee considered the inference of this sequence in S00028. The committee noted a rearrangement frequency of 0.7%, with 10188 alignments, though only 2443 perfect matches to the inferred allele. Alignments were also seen to three other IGHV3-7 sequences, though only one of these sequences was abundant (IGHV3-7*03: 20569 alignments, 4062 unmutated alignments). Haplotyping based on IGHJ6 alleles confirmed the segregation of reads associated with the two abundant alleles to the different haplotypes. Alignments to the *01 allele were at a trivial level (<0.01% of ‘unmutated’ alignments), though alignments to the *02 allele were seen in 0.09% of all unmutated sequences. They likely originated from an introduction of A318 as part of the V-DJ rearrangement process. This represented 3% of all alignments to the IGHV3-7 gene. There were 933 different CDR3s associated with the inference, including 233 different CDR3s associated with unmutated alignments. The committee agreed that the sequence should be accepted as a valid inference, which raises this sequence from Level 0 to Level 2. In line with previous policy, the submitted sequence is recognized up to and including nucleotide 319. A trailing “.” in the affirmed sequence indicates the IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. Reanalysis of the original submission at Meeting 43 of the IARC on October 7, 2019 again identified the same novel allele IGHV3-7*02_A318G with 12640 sequences and 2796 perfect matches and 269 Unique CDR3s with unmutated Seqs. In this analysis only one other allele of IGHV3-7 was seen (as very rare inferences had been removed by IgDiscover filtering), IGHV3-7*03 with 21677 sequences and 4120 perfect matches giving a 37:63 allelic ratio. These alleles were very well separated by IGHJ6-based haplotype analysis (100:0 and 1:99, respectively). The re-analysis thus confirmed the inference of IGHV3-7*i01 as a Level 2 sequence. In line with previous policy, the submitted sequence is recognized up to and including nucleotide 319. A trailing “.” in the affirmed sequence indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| Mats Ohlin 2019-01-01 22:47:01 | Version 1 published As noted at the IARC meeting on May 11, 2018, the IGHV3-7*01 sequence is established at level 0. |
| Mats Ohlin 2019-04-12 14:37:01 | Version 2 published In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation. |
| Andrew Collins 2019-10-31 04:05:43 | Version 3 published This sequence was affirmed at IARC Meeting 40, but after reanalysis of submission S00028, it was considered again at Meeting 43. Both meetings affirmed the sequence at level 2. The rearrangement frequencies noted at Meeting 40 were different to the frequencies finally accepted at Meeting 43. |
| Mats Ohlin 2019-11-26 20:56:51 | Version 4 published Updated with new IMGT name. |
| William Lees 2023-07-10 11:24:40 | Version 5 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| v4 | v5 | |
|---|---|---|
| Curator | William Lees | |
| Curator address | School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney Australia | Birkbeck College, University of London, Malet Street, London |
| Sequence Name | IGHV3-7*i01 | IGHV3-7*04 |
| Alternative names | IGHV3-7*i01 | |
| Mapped | True | |
| Functionality | F | ORF |
| Inference Type | Rearranged Only | Unrearranged and Rearranged |
| Affirmation Level | 2 | 1 |
| Species subgroup | ||
| Subgroup type | ||
| Allele Designation | i01 | 04 |
| Full Sequence | ||
| Gene start | 161 | |
| Gene end | 455 | |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 150 | |
| L-PART2 End | 160 | |
| CDR1 Start | 236 | |
| CDR1 End | 259 | |
| CDR2 Start | 311 | |
| CDR2 End | 334 | |
| CDR3 Start | 449 | |
| v_rs_start | 457 | |
| v_rs_end | 495 | |
| Paralog Rep | False | |
| Extension? | False | True |
| 3' Extension | A | |
| 5' Extension | ||
| curational_tags | likely_full-length | |
| Notes | changed |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGHV3-7*i01 | 1 | 2019-01-01 | |
| IGHV3-7*i01 | 2 | 2019-04-12 | |
| IGHV3-7*i01 | 3 | 2019-10-31 | |
| IGHV3-7*i01 | IGHV3-7*04 | 4 | 2019-11-26 |
| IGHV3-7*04 | IGHV3-7*04 | 5 | 2023-07-10 |