Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGHV3-7*04
IUIS NameIGHV3-7*04
Alternative namesIGHV3-7*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Evidence

The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission IDAccession NoSubject IDGenotype NameSequence NameSequence Match
S00028 MN244239A007A007 VHIGHV3-7*02_A318G

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
MN337620NonlocationalGenBank165659
BK010574InferredGenBank1295

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start236
CDR1 End259
CDR2 Start311
CDR2 End334
CDR3 Start449

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGAGTTGGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAGAAG
L-PART2 Start150
L-PART2 End160
L_PART2GTGTCCAGTGT
v_rs_start457
v_rs_end495
V_HEPTAMERCACAGTG
V_NONAMERACACAAACC

Extension

3' ExtensionA
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00006
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version5
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation7
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Originally assessed by IARC on May 11, 2018.

“The sequence is present at a moderate frequency (0.5%), in the IgDiscover analysis. No information was provided by the submitter regarding analysis with partis or TIgGER. Haplotype analysis could not be performed. Analysis for chimerism did not provide evidence against the existence of the sequence.
Extensive analysis was submitted, including four additional IgDiscover analyses using modified germline gene reference datasets. Although IARC were strongly persuaded by the submitted data, it was agreed that the sequence should be moved to Level 0. Issues relating to the end nucleotides deserve wider discussion by the Working Group before IMGT is notified of such a potentially controversial decision. This will be raised by AC at the forthcoming WG meeting.”

It has been noted that neither partis not TIgGER had been able to infer IGHV3-7*02 or any variant thereof while these tools inferred IGHV3-7*01 (see supplementary information privided with the submission ).

(April 12, 2019) In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

(August 7th 2019) At the 40th meeting of the IARC, the committee considered the inference of this sequence in S00028. The committee noted a rearrangement frequency of 0.7%, with 10188 alignments, though only 2443 perfect matches to the inferred allele. Alignments were also seen to three other IGHV3-7 sequences, though only one of these sequences was abundant (IGHV3-7*03: 20569 alignments, 4062 unmutated alignments). Haplotyping based on IGHJ6 alleles confirmed the segregation of reads associated with the two abundant alleles to the different haplotypes. Alignments to the *01 allele were at a trivial level (<0.01% of ‘unmutated’ alignments), though alignments to the *02 allele were seen in 0.09% of all unmutated sequences. They likely originated from an introduction of A318 as part of the V-DJ rearrangement process. This represented 3% of all alignments to the IGHV3-7 gene. There were 933 different CDR3s associated with the inference, including 233 different CDR3s associated with unmutated alignments. The committee agreed that the sequence should be accepted as a valid inference, which raises this sequence from Level 0 to Level 2. In line with previous policy, the submitted sequence is recognized up to and including nucleotide 319. A trailing “.” in the affirmed sequence indicates the IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation.

Reanalysis of the original submission at Meeting 43 of the IARC on October 7, 2019 again identified the same novel allele IGHV3-7*02_A318G with 12640 sequences and 2796 perfect matches and 269 Unique CDR3s with unmutated Seqs. In this analysis only one other allele of IGHV3-7 was seen (as very rare inferences had been removed by IgDiscover filtering), IGHV3-7*03 with 21677 sequences and 4120 perfect matches giving a 37:63 allelic ratio. These alleles were very well separated by IGHJ6-based haplotype analysis (100:0 and 1:99, respectively). The re-analysis thus confirmed the inference of IGHV3-7*i01 as a Level 2 sequence. In line with previous policy, the submitted sequence is recognized up to and including nucleotide 319. A trailing “.” in the affirmed sequence indicates IARC’s opinion that the sequence is likely to contain an additional 3’ nucleotide for which there is insufficient evidence to make an affirmation.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MN337620
VDJbase example haplotype: P1_I29
Mapped by P1_I29 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2019-01-01 22:47:01
Version 1 published

As noted at the IARC meeting on May 11, 2018, the IGHV3-7*01 sequence is established at level 0.

Mats Ohlin
2019-04-12 14:37:01
Version 2 published

In line with IARC policy, the submitted sequence was recognized up to and including nucleotide 319. A trailing “.” indicates IARC’s opinion that the sequences likely to contain an additional/additional 3’ nucleotide(s) for which there is insufficient evidence to make an affirmation.

Andrew Collins
2019-10-31 04:05:43
Version 3 published

This sequence was affirmed at IARC Meeting 40, but after reanalysis of submission S00028, it was considered again at Meeting 43. Both meetings affirmed the sequence at level 2. The rearrangement frequencies noted at Meeting 40 were different to the frequencies finally accepted at Meeting 43.

Mats Ohlin
2019-11-26 20:56:51
Version 4 published

Updated with new IMGT name.

William Lees
2023-07-10 11:24:40
Version 5 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v4v5
CuratorWilliam Lees
Curator addressSchool of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney AustraliaBirkbeck College, University of London, Malet Street, London
Sequence NameIGHV3-7*i01IGHV3-7*04
Alternative namesIGHV3-7*i01
MappedTrue
FunctionalityFORF
Inference TypeRearranged OnlyGenomic and rearranged
Affirmation Level21
Species subgroup
Subgroup type
Allele Designationi0104
Full Sequence
Gene start161
Gene end455
L-PART1 Start1
L-PART1 End46
L-PART2 Start150
L-PART2 End160
CDR1 Start236
CDR1 End259
CDR2 Start311
CDR2 End334
CDR3 Start449
v_rs_start457
v_rs_end495
Paralog RepFalse
Extension?FalseTrue
3' ExtensionA
5' Extension
curational_tagslikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeGene startGene endUTR 5' StartUTR 5' EndL-PART1 StartL-PART1 EndL-PART2 StartL-PART2 EndCDR1 StartCDR1 EndCDR2 StartCDR2 EndCDR3 Startv_rs_startv_rs_endd_rs_3_prime_startd_rs_3_prime_endd_rs_5_prime_startd_rs_5_prime_endj_rs_startj_rs_endCodon FrameVersionDate
IGHV3-7*i01Rearranged Only012019-01-01
IGHV3-7*i01Rearranged Only022019-04-12
IGHV3-7*i01Rearranged Only232019-10-31
IGHV3-7*i01IGHV3-7*04Rearranged Only242019-11-26
IGHV3-7*04IGHV3-7*04IGHV3-7*i01Genomic and rearranged116145514615016023625931133444945749552023-07-10