Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGHV3-9*03 |
IUIS Name | IGHV3-9*03 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 224 |
CDR1 End | 247 |
CDR2 Start | 299 |
CDR2 End | 322 |
CDR3 Start | 437 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGAGTTGGGACTGAGCTGGATTTTCCTTTTGGCTATTTTAAAAG |
L-PART2 Start | 138 |
L-PART2 End | 148 |
L_PART2 | GTGTCCAGTGT |
v_rs_start | 447 |
v_rs_end | 485 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02755 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 9 |
Allele Designation | 03 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:40 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGHV3-9*03 | IGHV3-9*03 | 1 | 2023-07-10 |