Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGLV2-14*04
IUIS NameIGLV2-14*04
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and Rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
CP068256NonlocationalGenBank2318171423182223

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start250
CDR1 End276
CDR2 Start328
CDR2 End336
CDR3 Start445

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAG
L-PART2 Start164
L-PART2 End174
L_PART2GGTCCTGGGCC
v_rs_start472
v_rs_end510
V_HEPTAMERCACAGTG
V_NONAMERACCAAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02900
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup2
Gene Designation14
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample CP068256

The 5’ extension relative to IMGT IGLV2-14*01 is supported by IARC analysis of Submission S00028, to which the following notes refer:

Assessed by IARC on July 7, 2020 during meeting 57. The committee considered IGLV2-14*04x (a 5’ extension of IGLV2-14*04) of submission S00028.

The sequence was seen in 6.88% of all unmutated rearrangements, with 21083 sequences including 8224 perfect matches to the inferred allele. The library had been generated from PBMC that had not been sorted for naïve B cells, resulting in the presence of reads of somatically hypermutated sequences in the data set, a fact that complicates the analysis. There was abundant variation in the CDR3 regions of the aligned sequences to an extent similar to that of other lambda germline alleles of this donor. One other alleles was present in the genotype. Haplotyping could not be performed. The inferred sequence includes 23 bases added to the 5’-end of incomplete reference allele IGLV2-14*04. There was support for the sequence being affirmed up to and including nucleotide 337, in line with IARC policy not to infer bases substantially affected by trimming dring the rearrangement process, as a Level 1 sequence, with two additional 3’ nucleotide being likely present in the sequence.

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:46
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGLV2-14*04IGLV2-14*0412023-07-10