Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV2-14*04 |
IUIS Name | IGLV2-14*04 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Unrearranged and Rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
CP068256 | Nonlocational | GenBank | 23181714 | 23182223 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 250 |
CDR1 End | 276 |
CDR2 Start | 328 |
CDR2 End | 336 |
CDR3 Start | 445 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGGCTCTGCTATTCCTCACCCTCCTCACTCAGGGCACAG |
L-PART2 Start | 164 |
L-PART2 End | 174 |
L_PART2 | GGTCCTGGGCC |
v_rs_start | 472 |
v_rs_end | 510 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACCAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02900 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 2 |
Gene Designation | 14 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: The 5’ extension relative to IMGT IGLV2-14*01 is supported by IARC analysis of Submission S00028, to which the following notes refer: Assessed by IARC on July 7, 2020 during meeting 57. The committee considered IGLV2-14*04x (a 5’ extension of IGLV2-14*04) of submission S00028. The sequence was seen in 6.88% of all unmutated rearrangements, with 21083 sequences including 8224 perfect matches to the inferred allele. The library had been generated from PBMC that had not been sorted for naïve B cells, resulting in the presence of reads of somatically hypermutated sequences in the data set, a fact that complicates the analysis. There was abundant variation in the CDR3 regions of the aligned sequences to an extent similar to that of other lambda germline alleles of this donor. One other alleles was present in the genotype. Haplotyping could not be performed. The inferred sequence includes 23 bases added to the 5’-end of incomplete reference allele IGLV2-14*04. There was support for the sequence being affirmed up to and including nucleotide 337, in line with IARC policy not to infer bases substantially affected by trimming dring the rearrangement process, as a Level 1 sequence, with two additional 3’ nucleotide being likely present in the sequence. |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV2-14*04 | IGLV2-14*04 | 1 | 2023-07-10 |