Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV5-37*02
IUIS NameIGLV5-37*02
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
Gibson:NA18507LocationalGenBank6535

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start255
CDR1 End281
CDR2 Start333
CDR2 End353
CDR3 Start468

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGACTCCTCTTCTTCTCTTGCTCCTCTCTCACTGCACAG
L-PART2 Start169
L-PART2 End179
L_PART2GTTCCCTCTCC
v_rs_start492
v_rs_end530
V_HEPTAMERCACAGTG
V_NONAMERACAAAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02934
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup5
Gene Designation37
Allele Designation02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:NA18507

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:48
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:39:36
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Subgroup typenone
Full Sequence
Gene start185180
Gene end496491
L-PART1 Start1
L-PART1 End46
L-PART2 Start174169
L-PART2 End184179
CDR1 Start260255
CDR1 End286281
CDR2 Start338333
CDR2 End358353
CDR3 Start473468
v_rs_start497492
v_rs_end535530
Codon Frame1
3' Extension
5' Extension

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV5-37*02IGLV5-37*02Genomic Only112023-07-10
IGLV5-37*02IGLV5-37*02Genomic Only1none22024-02-22