Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGHV3-30-42*01
IUIS NameIGHV3-30-42*01
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityP
Inference TypeGenomic and rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
AC244456NonlocationalGenBank2271023206

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End48
L_PART1ATGGGGTGTGAATTAAGCTGAATTTTTCTTGTTGGTATTTTAAAAGGT
L-PART2 Start150
L-PART2 End160
L_PART2GTGTTCAGTGT
v_rs_start459
v_rs_end497
V_HEPTAMERCCAAGTG
V_NONAMERACACAAAAT

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02996
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-08-20
Release Notes

Reported as mapped to the genomic location 3-30-42 in Watson et al., 2013 and confirmed by AIRR-seq in the VDJbase Gidoni et al. study

LocusIGH
Sequence TypeV
Gene Subgroup3-30
Gene Designation42
Allele Designation01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample AC244456. VDJbase example haplotype: P1_I64_S1

Pseudogene – does not qualify for reference set unless ORFs are found at this gene position

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-08-20 15:49:42
Version 1 published

Reported as mapped to the genomic location 3-30-42 in Watson et al., 2013 and confirmed by AIRR-seq in the VDJbase Gidoni et al. study

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV3-30-42*01IGHV3-30-42*01Genomic and rearranged1none12023-08-20