Sequence IGHV3-30-42*01
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGHV3-30-42*01 |
| IUIS Name | IGHV3-30-42*01 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | P |
| Inference Type | Unrearranged and Rearranged |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| AC244456 | Nonlocational | GenBank | 22710 | 23206 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 236 |
| CDR1 End | 259 |
| CDR2 Start | 311 |
| CDR2 End | 334 |
| CDR3 Start | 449 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 48 |
| L_PART1 | ATGGGGTGTGAATTAAGCTGAATTTTTCTTGTTGGTATTTTAAAAGGT |
| L-PART2 Start | 150 |
| L-PART2 End | 160 |
| L_PART2 | GTGTTCAGTGT |
| v_rs_start | 459 |
| v_rs_end | 497 |
| V_HEPTAMER | CCAAGTG |
| V_NONAMER | ACACAAAAT |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02996 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 1 |
| Release Date | 2023-08-20 |
| Release Notes | Reported as mapped to the genomic location 3-30-42 in Watson et al., 2013 and confirmed by AIRR-seq in the VDJbase Gidoni et al. study |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 3-30 |
| Gene Designation | 42 |
| Allele Designation | 01 |
| Gene start | 161 |
| Gene end | 458 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: Pseudogene – does not qualify for reference set unless ORFs are found at this gene position |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-08-20 15:49:42 | Version 1 published Reported as mapped to the genomic location 3-30-42 in Watson et al., 2013 and confirmed by AIRR-seq in the VDJbase Gidoni et al. study |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGHV3-30-42*01 | IGHV3-30-42*01 | 1 | 2023-08-20 |