Details


Species	Homo sapiens
Species subgroup
Subgroup type
Sequence Name	IGLV7-46*04
IUIS Name	IGLV7-46*04
Alternative names	IGLV7-46*i01
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Genomic and rearranged
Mapped	False
Paralogs
Paralog Rep	False

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
OL352718	Locational	GenBank
MW316675	Nonlocational	GenBank	210	687
MK308867	Inferred	GenBank	1	294
Gibson:HG01106	Locational	GenBank	35	512

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation


CDR1 Start	221
CDR1 End	247
CDR2 Start	299
CDR2 End	307
CDR3 Start	416

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start	1
L-PART1 End	46
L_PART1	ATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAG
L-PART2 Start	135
L-PART2 End	145
L_PART2	GGTCCAATTCC
v_rs_start	440
v_rs_end	478
V_HEPTAMER	CACAGTG
V_NONAMER	ACATAAACC

Extension


3' Extension
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A00058
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	2
Release Date	2023-07-10
Release Notes	Bulk upload of sequences for the AIRR-C Human IG germline sets
Locus	IGL
Sequence Type	V
Gene Subgroup	7
Gene Designation	46
Allele Designation	04
Gene start	146
Gene end	439

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


IARC Meeting 57 (July 7th 2020): The meeting considered the inference of a variant of the IGLV7-46 sequence in Genotype A007 VL, Submission S00028. The variant was present at a relatively low frequency, being seen in just 0.03% of all unmutated rearrangements, with a total of 656 alignments including 31 perfect alignments to the inferred allele. The submitted sequence was rejected by the committee as supporting inference data was insufficient. IARC Meeting 58 (July 20th 2020): The meeting re-considered the inference of the variant IGLV7-46 sequence in Genotype A007 VL, Submission S00028. This sequence had been rejected at the previous IARC meeting because of insufficient data – a low percentage of apparently unmutated sequences, and a low total number of sequences aligned to the variant. The sequence has been independently reported in Genbank, and a genomic sequence has been submitted to Genbank. The IARC members all agreed that the sequence is likely to be a real variant. Discussion again resulted in agreement that it is the task of the IARC to evaluate the data that is before it, though it was also agreed that other separate evidence can be noted. As a consequence it was agreed that the sequence should be affirmed as a Level 0 sequence. IARC Meeting 102 (July 26, 2022) As IGLV7-46i01 now features in the IMGT database as IGLV7-4604 with additional, independent genomic support (GenBank: OL352718) it is promoted to level 1. IARC Meeting 106 (Sept 27th, 2022) IGHV7-46i01 was originally considered at IARC meetings 57 and 58 and affirmed as a level 0 sequence. Following its inclusion into IMGT based on genomic sequence data it was elevated to level 1 at IARC meeting 102. The affirmed 3’-end was however never considered. It was decided that the inferred allele at the present stage should not be released into the public domain of OGRDB based on supporting genomic evidence (GenBank: OL352718) of data of an unrelated subject until a subsequent decision on the integration of genomic and transcriptomic data can has been made (to be discussed at a subsequent meeting). IARC Meeting 107 (Oct 19, 2022) Decision: The IGLV7-46i01 allele (full length) is approved and moved to level 1 based on its own merits (inference) in combination with genomic data from the subject in question (genomic sequence amplified by PCR (GenBank MK587528) and another subject. A process for incorporation of Sanger-based genomic data in IARC’s decision-making process will be discussed and established. A process for incorporating genomic data of other origin in IARC’s decision-making process will be discussed and established through discussion with data generators. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample MW316675

IARC Meeting 57 (July 7th 2020):
The meeting considered the inference of a variant of the IGLV7-46 sequence in Genotype A007 VL, Submission S00028. The variant was present at a relatively low frequency, being seen in just 0.03% of all unmutated rearrangements, with a total of 656 alignments including 31 perfect alignments to the inferred allele. The submitted sequence was rejected by the committee as supporting inference data was insufficient.

IARC Meeting 58 (July 20th 2020):
The meeting re-considered the inference of the variant IGLV7-46 sequence in Genotype A007 VL, Submission S00028. This sequence had been rejected at the previous IARC meeting because of insufficient data – a low percentage of apparently unmutated sequences, and a low total number of sequences aligned to the variant. The sequence has been independently reported in Genbank, and a genomic sequence has been submitted to
Genbank. The IARC members all agreed that the sequence is likely to be a real variant. Discussion again resulted in agreement that it is the task of the IARC to evaluate the data that is before it, though it was also agreed that other separate evidence can be noted. As a consequence it was agreed that the sequence should be affirmed as a Level 0 sequence.

IARC Meeting 102 (July 26, 2022)
As IGLV7-46*i01 now features in the IMGT database as IGLV7-46*04 with additional, independent genomic support (GenBank: OL352718) it is promoted to level 1.

IARC Meeting 106 (Sept 27th, 2022)
IGHV7-46*i01 was originally considered at IARC meetings 57 and 58 and affirmed as a level 0 sequence. Following its inclusion into IMGT based on genomic sequence data it was elevated to level 1 at IARC meeting 102. The affirmed 3’-end was however never considered. It was decided that the inferred allele at the present stage should not be released into the public domain of OGRDB based on supporting genomic evidence (GenBank: OL352718) of data of an unrelated subject until a subsequent decision on the integration of genomic and transcriptomic data can has been made (to be discussed at a subsequent meeting).

IARC Meeting 107 (Oct 19, 2022)
Decision:

The IGLV7-46*i01 allele (full length) is approved and moved to level 1 based on its own merits (inference) in combination with genomic data from the subject in question (genomic sequence amplified by PCR (GenBank MK587528) and another subject.
A process for incorporation of Sanger-based genomic data in IARC’s decision-making process will be discussed and established.
A process for incorporating genomic data of other origin in IARC’s decision-making process will be discussed and established through discussion with data generators.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316675

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2022-11-18 07:31:28	Version 1 published Published on Nov 18, 2022


William Lees 2023-07-10 11:24:48	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

	v1	v2
Curator		William Lees
Curator address	School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney Australia	Birkbeck College, University of London, Malet Street, London
Sequence Name	IGLV7-46*i01	IGLV7-46*04
Alternative names	IGLV7-4601_S3303, IGLV7-4601_A213C	IGLV7-46*i01
Mapped		False
Functionality	F	ORF
Inference Type	Rearranged	Genomic and rearranged
Subgroup type	none
Allele Designation	i01	04
Full Sequence
Gene start	1	146
Gene end	294	439
L-PART1 Start		1
L-PART1 End		46
L-PART2 Start		135
L-PART2 End		145
CDR1 Start	76	221
CDR1 End	102	247
CDR2 Start	154	299
CDR2 End	162	307
CDR3 Start	271	416
v_rs_start		440
v_rs_end		478
Codon Frame	1
Paralog Rep		False
3' Extension
5' Extension
curational_tags	none	likely_full-length
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Version	Date
IGLV7-46*i01	IGLV7-46*04	1	2022-11-18
IGLV7-46*04	IGLV7-46*04	2	2023-07-10