Species | Human |
Species subgroup | |
Subgroup type | |
Sequence Name | IGLV7-46*04 |
IUIS Name | IGLV7-46*04 |
Alternative names | IGLV7-46*i01 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
OL352718 | Locational | GenBank | ||
MW316675 | Nonlocational | GenBank | 210 | 687 |
MK308867 | Inferred | GenBank | 1 | 294 |
Gibson:HG01106 | Locational | GenBank | 35 | 512 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 221 |
CDR1 End | 247 |
CDR2 Start | 299 |
CDR2 End | 307 |
CDR3 Start | 416 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAG |
L-PART2 Start | 135 |
L-PART2 End | 145 |
L_PART2 | GGTCCAATTCC |
v_rs_start | 440 |
v_rs_end | 478 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACATAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A00058 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 7 |
Gene Designation | 46 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
IARC Meeting 57 (July 7th 2020): IARC Meeting 58 (July 20th 2020): IARC Meeting 102 (July 26, 2022) IARC Meeting 106 (Sept 27th, 2022) IARC Meeting 107 (Oct 19, 2022)
Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
Mats Ohlin 2022-11-18 07:31:28 | Version 1 published Published on Nov 18, 2022 |
William Lees 2023-07-10 11:24:48 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
v1 | v2 | |
---|---|---|
Curator | William Lees | |
Curator address | School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney Australia | Birkbeck College, University of London, Malet Street, London |
Sequence Name | IGLV7-46*i01 | IGLV7-46*04 |
Alternative names | IGLV7-46*01_S3303, IGLV7-46*01_A213C | IGLV7-46*i01 |
Mapped | False | |
Functionality | F | ORF |
Inference Type | Rearranged | Genomic and rearranged |
Subgroup type | none | |
Allele Designation | i01 | 04 |
Full Sequence | ||
Gene start | 1 | 146 |
Gene end | 294 | 439 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 135 | |
L-PART2 End | 145 | |
CDR1 Start | 76 | 221 |
CDR1 End | 102 | 247 |
CDR2 Start | 154 | 299 |
CDR2 End | 162 | 307 |
CDR3 Start | 271 | 416 |
v_rs_start | 440 | |
v_rs_end | 478 | |
Codon Frame | 1 | |
Paralog Rep | False | |
3' Extension | ||
5' Extension | ||
curational_tags | none | likely_full-length |
Notes | changed |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGLV7-46*i01 | IGLV7-46*04 | IGLV7-46*01_S3303, IGLV7-46*01_A213C | Rearranged | 1 | none | 1 | 294 | 76 | 102 | 154 | 162 | 271 | 1 | 1 | 2022-11-18 | |||||||||||||||
IGLV7-46*04 | IGLV7-46*04 | IGLV7-46*i01 | Genomic and rearranged | 1 | 146 | 439 | 1 | 46 | 135 | 145 | 221 | 247 | 299 | 307 | 416 | 440 | 478 | 2 | 2023-07-10 |