Details

SpeciesHomo sapiens
Species subgroup
Subgroup type
Sequence NameIGLV7-46*04
IUIS NameIGLV7-46*04
Alternative namesIGLV7-46*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and Rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
OL352718LocationalGenBank3301433508
MW316675NonlocationalGenBank210687
MK308867InferredGenBank1294
Gibson:HG01106LocationalGenBank35512

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start221
CDR1 End247
CDR2 Start299
CDR2 End307
CDR3 Start416

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAG
L-PART2 Start135
L-PART2 End145
L_PART2GGTCCAATTCC
v_rs_start440
v_rs_end478
V_HEPTAMERCACAGTG
V_NONAMERACATAAACC
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00058
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup7
Gene Designation46
Allele Designation04
Gene start146
Gene end439

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

IARC Meeting 57 (July 7th 2020):
The meeting considered the inference of a variant of the IGLV7-46 sequence in Genotype A007 VL, Submission S00028. The variant was present at a relatively low frequency, being seen in just 0.03% of all unmutated rearrangements, with a total of 656 alignments including 31 perfect alignments to the inferred allele. The submitted sequence was rejected by the committee as supporting inference data was insufficient.

IARC Meeting 58 (July 20th 2020):
The meeting re-considered the inference of the variant IGLV7-46 sequence in Genotype A007 VL, Submission S00028. This sequence had been rejected at the previous IARC meeting because of insufficient data – a low percentage of apparently unmutated sequences, and a low total number of sequences aligned to the variant. The sequence has been independently reported in Genbank, and a genomic sequence has been submitted to
Genbank. The IARC members all agreed that the sequence is likely to be a real variant. Discussion again resulted in agreement that it is the task of the IARC to evaluate the data that is before it, though it was also agreed that other separate evidence can be noted. As a consequence it was agreed that the sequence should be affirmed as a Level 0 sequence.

IARC Meeting 102 (July 26, 2022)
As IGLV7-46*i01 now features in the IMGT database as IGLV7-46*04 with additional, independent genomic support (GenBank: OL352718) it is promoted to level 1.

IARC Meeting 106 (Sept 27th, 2022)
IGHV7-46*i01 was originally considered at IARC meetings 57 and 58 and affirmed as a level 0 sequence. Following its inclusion into IMGT based on genomic sequence data it was elevated to level 1 at IARC meeting 102. The affirmed 3’-end was however never considered. It was decided that the inferred allele at the present stage should not be released into the public domain of OGRDB based on supporting genomic evidence (GenBank: OL352718) of data of an unrelated subject until a subsequent decision on the integration of genomic and transcriptomic data can has been made (to be discussed at a subsequent meeting).

IARC Meeting 107 (Oct 19, 2022)
Decision:

  • The IGLV7-46*i01 allele (full length) is approved and moved to level 1 based on its own merits (inference) in combination with genomic data from the subject in question (genomic sequence amplified by PCR (GenBank MK587528) and another subject.
  • A process for incorporation of Sanger-based genomic data in IARC’s decision-making process will be discussed and established.
  • A process for incorporating genomic data of other origin in IARC’s decision-making process will be discussed and established through discussion with data generators.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316675

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2022-11-18 07:31:28
Version 1 published

Published on Nov 18, 2022

William Lees
2023-07-10 11:24:48
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorWilliam Lees
Curator addressSchool of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney AustraliaBirkbeck College, University of London, Malet Street, London
Sequence NameIGLV7-46*i01IGLV7-46*04
Alternative namesIGLV7-46*01_S3303, IGLV7-46*01_A213CIGLV7-46*i01
MappedFalse
FunctionalityFORF
Inference TypeRearranged OnlyUnrearranged and Rearranged
Subgroup typenone
Allele Designationi0104
Full Sequence
Gene start1146
Gene end294439
L-PART1 Start1
L-PART1 End46
L-PART2 Start135
L-PART2 End145
CDR1 Start76221
CDR1 End102247
CDR2 Start154299
CDR2 End162307
CDR3 Start271416
v_rs_start440
v_rs_end478
Codon Frame1
Paralog RepFalse
3' Extension
5' Extension
curational_tagsnonelikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
IGLV7-46*i01IGLV7-46*0412022-11-18
IGLV7-46*04IGLV7-46*0422023-07-10