Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV10-54*05 |
IUIS Name | IGLV10-54*05 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
Gibson:NA18507 | Locational | GenBank | 1 | 504 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 245 |
CDR1 End | 268 |
CDR2 Start | 320 |
CDR2 End | 328 |
CDR3 Start | 437 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAG |
L-PART2 Start | 159 |
L-PART2 End | 169 |
L_PART2 | TGTCAGTGGTC |
v_rs_start | 466 |
v_rs_end | 504 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ATAAAAACT |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02894 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | http://ogrdb.airr-community.org/sequence/A02880 |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 10 |
Gene Designation | 54 |
Allele Designation | 05 |
Gene start | 170 |
Gene end | 465 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:31:25 | Version 2 published http://ogrdb.airr-community.org/sequence/A02880 |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
Codon Frame | 1 | |
3' Extension | ||
5' Extension |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV10-54*05 | IGLV10-54*05 | 1 | 2023-07-10 |
IGLV10-54*05 | IGLV10-54*05 | 2 | 2024-02-22 |