Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV7-46*01
IUIS NameIGLV7-46*01
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
Z22205NonlocationalGenBank1294

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start222
CDR1 End248
CDR2 Start300
CDR2 End308
CDR3 Start417

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAG
L-PART2 Start136
L-PART2 End146
L_PART2GGTCCAATTCC
v_rs_start441
v_rs_end479
V_HEPTAMERCACAGTG
V_NONAMERACATAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02948
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup7
Gene Designation46
Allele Designation01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:NA19240

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:48
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:41:45
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Subgroup typenone
Full Sequence
Gene start181147
Gene end474440
L-PART1 Start1
L-PART1 End46
L-PART2 Start170136
L-PART2 End180146
CDR1 Start256222
CDR1 End282248
CDR2 Start334300
CDR2 End342308
CDR3 Start451417
v_rs_start475441
v_rs_end513479
Codon Frame1
3' Extension
5' Extension

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV7-46*01IGLV7-46*01Genomic Only112023-07-10
IGLV7-46*01IGLV7-46*01Genomic Only1none22024-02-22