Species | Human |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV1-36*01_c330g |
IUIS Name | |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGLV1-36*01_c330g | 4 |
Un-rearranged sequence observations that support this sequence:
CDR1 Start | 248 |
CDR1 End | 271 |
CDR2 Start | 323 |
CDR2 End | 331 |
CDR3 Start | 440 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGTCCCCTCTCTTCCTCACCCTCATCACTCACTGTGCAG |
L-PART2 Start | 162 |
L-PART2 End | 172 |
L_PART2 | GGTCCTGGGCC |
v_rs_start | 469 |
v_rs_end | 507 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAGAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02880 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 1 |
Gene Designation | 36 |
Allele Designation | 01_c330g |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:45 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:24:59 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Full Sequence | ||
Gene start | 213 | 173 |
Gene end | 508 | 468 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 202 | 162 |
L-PART2 End | 212 | 172 |
CDR1 Start | 288 | 248 |
CDR1 End | 311 | 271 |
CDR2 Start | 363 | 323 |
CDR2 End | 371 | 331 |
CDR3 Start | 480 | 440 |
v_rs_start | 509 | 469 |
v_rs_end | 547 | 507 |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGLV1-36*01_c330g | Genomic Only | 1 | none | 213 | 508 | 202 | 212 | 288 | 311 | 363 | 371 | 480 | 509 | 547 | 1 | 1 | 2023-07-10 | |||||||||||||
IGLV1-36*01_c330g | Genomic Only | 1 | none | 173 | 468 | 1 | 46 | 162 | 172 | 248 | 271 | 323 | 331 | 440 | 469 | 507 | 1 | 2 | 2024-02-22 |