| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV1-36*01_c330g |
| IUIS Name | |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged Only |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 248 |
| CDR1 End | 271 |
| CDR2 Start | 323 |
| CDR2 End | 331 |
| CDR3 Start | 440 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGTCCCCTCTCTTCCTCACCCTCATCACTCACTGTGCAG |
| L-PART2 Start | 162 |
| L-PART2 End | 172 |
| L_PART2 | GGTCCTGGGCC |
| v_rs_start | 469 |
| v_rs_end | 507 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAGAACC |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A02880 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 36 |
| Allele Designation | 01_c330g |
| Gene start | 173 |
| Gene end | 468 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:45 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:24:59 | Version 2 published Supporting sequence and annotation updated |
| v1 | v2 | |
|---|---|---|
| Full Sequence | ||
| Gene start | 213 | 173 |
| Gene end | 508 | 468 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 202 | 162 |
| L-PART2 End | 212 | 172 |
| CDR1 Start | 288 | 248 |
| CDR1 End | 311 | 271 |
| CDR2 Start | 363 | 323 |
| CDR2 End | 371 | 331 |
| CDR3 Start | 480 | 440 |
| v_rs_start | 509 | 469 |
| v_rs_end | 547 | 507 |
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGLV1-36*01_c330g | 1 | 2023-07-10 | |
| IGLV1-36*01_c330g | 2 | 2024-02-22 |