Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV1-36*01_c330g
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGLV1-36*01_c330g 4

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation

CDR1 Start248
CDR1 End271
CDR2 Start323
CDR2 End331
CDR3 Start440

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGTCCCCTCTCTTCCTCACCCTCATCACTCACTGTGCAG
L-PART2 Start162
L-PART2 End172
L_PART2GGTCCTGGGCC
v_rs_start469
v_rs_end507
V_HEPTAMERCACAGTG
V_NONAMERACAAGAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02880
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup1
Gene Designation36
Allele Designation01_c330g

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG02572

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:45
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:24:59
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Full Sequence
Gene start213173
Gene end508468
L-PART1 Start1
L-PART1 End46
L-PART2 Start202162
L-PART2 End212172
CDR1 Start288248
CDR1 End311271
CDR2 Start363323
CDR2 End371331
CDR3 Start480440
v_rs_start509469
v_rs_end547507

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV1-36*01_c330gGenomic Only1none12023-07-10
IGLV1-36*01_c330gGenomic Only1none22024-02-22