Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGHV2-26*04
IUIS NameIGHV2-26*04
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
AC280062NonlocationalGenBank2293423416

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGACACGCTTTGCTACACACTCCTGCTGCTGACCACCCCTTCCT
L-PART2 Start133
L-PART2 End143
L_PART2GGGTCTTGTCC
v_rs_start445
v_rs_end483
V_HEPTAMERCACAGAG
V_NONAMERACAAGAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02964
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-08-15
Release Notes

Sequences added following discussion at IARC meeting on 9th August 2023

LocusIGH
Sequence TypeV
Gene Subgroup2
Gene Designation26
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample AC280062. VDJbase example haplotype: P1_I59. Sequence observed in data from Rodriguez et al.
2023 as reported in VDJbase (10 samples). Example subject: P25_I7.

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-08-15 12:54:48
Version 1 published

Sequences added following discussion at IARC meeting on 9th August 2023

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV2-26*04IGHV2-26*04Genomic Only112023-08-15