Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGHV4-39*09
IUIS NameIGHV4-39*09
Alternative namesIGHV4-39*i02
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeRearranged Only
MappedTrue
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGHV4-39*07_c288a 4

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
OU596103InferredGenBank1298

Extension

3' ExtensionA
3' start
3' end

Additional Information

Sequence IDA00071
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGH
Sequence TypeV
Gene Subgroup4
Gene Designation39
Allele Designation09

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

IARC meeting 63, Nov 24th, 2020:
The meeting considered the inference of the variant IGHV4-39*07_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC-meeting 84, Oct 25th, 2021:
IGHV4-39*07_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-39*01. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*07_C288A: 99:1; IGHV4-39*01: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39*i02.

>IGHV4-39*i02 (IGHV4-39*07_C288A)
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OU596103
VDJbase example haplotype: P1_I29 (*07_c288a)
VDJbase example haplotype: P1_I29 (*07_c288a)
Mapped by P1_I29 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:50:46
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:25:43
IMGT Name updated to IGHV4-39*09

IMGT Name updated.

William Lees
2023-07-10 11:24:41
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorMats OhlinWilliam Lees
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, SwedenBirkbeck College, University of London, Malet Street, London
Sequence NameIGHV4-39*i02IGHV4-39*09
Alternative namesIGHV4-39*i02
Chromosome14
MappedTrue
FunctionalityFORF
Subgroup typenone
Allele Designationi0209
Full Sequence
Gene start1
Gene end298
Codon Frame1
Paralog RepFalse
Extension?FalseTrue
3' ExtensionA
5' Extension
curational_tagsnonelikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV4-39*i02IGHV4-39*09Rearranged Only1none12021-11-01
IGHV4-39*09IGHV4-39*09IGHV4-39*i02Rearranged Only122023-07-10