OGRDB

Details


Species	Homo sapiens
Species subgroup
Subgroup type
Sequence Name	IGHV4-39*09
IUIS Name	IGHV4-39*09
Alternative names	IGHV4-39*i02
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Rearranged Only
Mapped	True
Paralogs
Paralog Rep	False

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
OU596103	Inferred	GenBank	1	298

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation


CDR1 Start	76
CDR1 End	105
CDR2 Start	157
CDR2 End	177
CDR3 Start	292

Extension


3' Extension	A
3' start
3' end

Additional Information


Sequence ID	A00071
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	2
Release Date	2023-07-10
Release Notes	Bulk upload of sequences for the AIRR-C Human IG germline sets
Locus	IGH
Sequence Type	V
Gene Subgroup	4
Gene Designation	39
Allele Designation	09
Gene start	1
Gene end	298

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


IARC meeting 63, Nov 24th, 2020: The meeting considered the inference of the variant IGHV4-3907_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-3901 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes. IARC-meeting 84, Oct 25th, 2021: IGHV4-3907_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-3901. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-3907_C288A: 99:1; IGHV4-3901: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39i02. >IGHV4-39i02 (IGHV4-3907_C288A) CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample OU596103 VDJbase example haplotype: P1_I29 (07_c288a) VDJbase example haplotype: P1_I29 (*07_c288a) Mapped by P1_I29 haplotype

IARC meeting 63, Nov 24th, 2020:
The meeting considered the inference of the variant IGHV4-39*07_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC-meeting 84, Oct 25th, 2021:
IGHV4-39*07_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-39*01. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*07_C288A: 99:1; IGHV4-39*01: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39*i02.

>IGHV4-39*i02 (IGHV4-39*07_C288A)
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OU596103
VDJbase example haplotype: P1_I29 (*07_c288a)
VDJbase example haplotype: P1_I29 (*07_c288a)
Mapped by P1_I29 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:50:46	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:25:43	*IMGT Name updated to IGHV4-3909** IMGT Name updated.


William Lees 2023-07-10 11:24:41	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

	v1	v2
Curator	Mats Ohlin	William Lees
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden	Birkbeck College, University of London, Malet Street, London
Sequence Name	IGHV4-39*i02	IGHV4-39*09
Alternative names		IGHV4-39*i02
Chromosome		14
Mapped		True
Functionality	F	ORF
Subgroup type	none
Allele Designation	i02	09
Full Sequence
Codon Frame	1
Paralog Rep		False
Extension?	False	True
3' Extension		A
5' Extension
curational_tags	none	likely_full-length
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Version	Date
IGHV4-39*i02	IGHV4-39*09	1	2021-11-01
IGHV4-39*09	IGHV4-39*09	2	2023-07-10