Details


Species	Human
Species subgroup
Subgroup type
Sequence Name	IGHV4-39*09
IUIS Name	IGHV4-39*09
Alternative names	IGHV4-39*i02
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Rearranged Only
Mapped	True
Paralogs
Paralog Rep	False

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV4-39*07_c288a	4

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
OU596103	Inferred	GenBank	1	298

CDR delineation


CDR1 Start	76
CDR1 End	105
CDR2 Start	157
CDR2 End	177
CDR3 Start	292

Extension


3' Extension	A
3' start
3' end

Additional Information


Sequence ID	A00071
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	2
Release Date	2023-07-10
Release Notes	Bulk upload of sequences for the AIRR-C Human IG germline sets
Locus	IGH
Sequence Type	V
Gene Subgroup	4
Gene Designation	39
Allele Designation	09

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


IARC meeting 63, Nov 24th, 2020: The meeting considered the inference of the variant IGHV4-3907_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-3901 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes. IARC-meeting 84, Oct 25th, 2021: IGHV4-3907_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-3901. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-3907_C288A: 99:1; IGHV4-3901: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39i02. >IGHV4-39i02 (IGHV4-3907_C288A) CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG. Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample OU596103 VDJbase example haplotype: P1_I29 (07_c288a) VDJbase example haplotype: P1_I29 (*07_c288a) Mapped by P1_I29 haplotype

IARC meeting 63, Nov 24th, 2020:
The meeting considered the inference of the variant IGHV4-39*07_c288a in the VDJbase datasets of sample P1_I29_S1. (It was present in two other VDJbase samples). The sequence was seen in 4.61% of all unmutated rearrangements, with 1201 sequences including 1068 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV4-39*01 was also present in the genotype, at a similar frequency (4.35% of all unmutated sequences, 1135 sequences, 1009 unmutated sequences). Plots of the final 3’ nucleotides were unavailable. Haplotyping data strongly supported the inference. The sequence was tentatively affirmed as a Level 1 sequence, and the final 3’ nucleotides will be considered at a later date, when terminal nucleotide plots become available, at which time the affirmed sequence will be noted in the IARC minutes.

IARC-meeting 84, Oct 25th, 2021:
IGHV4-39*07_C288A was inferred in subject S29 (VDJ-base: P1_I29_S1). This inference has previously been pre-assessed at IARC meeting 63 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2020/12/Meeting-63-24_11_20-minutes.pdf). The genotype also carried IGHV4-39*01. The inference was supported by many sequences (1304) and unmutated sequences (1107) a balanced allelic frequency (52%), a high overall frequency in the unmutated population (5.7%) and many unique CDR3s (1086) in the unmutated sequence set. Haplotyping based on allelic diversity in IGHJ6 was possible and the alleles distributed well between haplotypes (IGHV4-39*07_C288A: 99:1; IGHV4-39*01: 0:100). IARC infers the sequence at level 1 up to and including base 319 in agreement with past practice. It is acknowledged that the allele most likely carry one additional base, typically A at base position 320. The allele is given the name IGHV4-39*i02.

>IGHV4-39*i02 (IGHV4-39*07_C288A)
CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGCAGTAGTAGTTACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCAGCGGACACGGCCGTGTATTACTGTGCGAGAG.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OU596103
VDJbase example haplotype: P1_I29 (*07_c288a)
VDJbase example haplotype: P1_I29 (*07_c288a)
Mapped by P1_I29 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:50:46	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:25:43	*IMGT Name updated to IGHV4-3909** IMGT Name updated.


William Lees 2023-07-10 11:24:41	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

	v1	v2
Curator	Mats Ohlin	William Lees
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden	Birkbeck College, University of London, Malet Street, London
Sequence Name	IGHV4-39*i02	IGHV4-39*09
Alternative names		IGHV4-39*i02
Chromosome		14
Mapped		True
Functionality	F	ORF
Subgroup type	none
Allele Designation	i02	09
Full Sequence
Codon Frame	1
Paralog Rep		False
Extension?	False	True
3' Extension		A
5' Extension
curational_tags	none	likely_full-length
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Species subgroup	Subgroup type	Gene start	Gene end	UTR 5' Start	UTR 5' End	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	d_rs_3_prime_start	d_rs_3_prime_end	d_rs_5_prime_start	d_rs_5_prime_end	j_rs_start	j_rs_end	Codon Frame	Version	Date
IGHV4-39*i02	IGHV4-39*09		Rearranged Only	1		none	1	298							76	105	157	177	292									1	1	2021-11-01
IGHV4-39*09	IGHV4-39*09	IGHV4-39*i02	Rearranged Only	1			1	298							76	105	157	177	292										2	2023-07-10