Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV3-25*03_g74c
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGLV3-25*03_g74c 26

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation

CDR1 Start299
CDR1 End316
CDR2 Start368
CDR2 End376
CDR3 Start485

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGATCCCTCTACTTCTCCCCCTCCTCACTCTCTGCACAG
L-PART2 Start213
L-PART2 End223
L_PART2GCTCTGAGGCC
v_rs_start514
v_rs_end552
V_HEPTAMERCACAGTG
V_NONAMERACATAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02925
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup3
Gene Designation25
Allele Designation03_g74c

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG01106

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:47
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:38:33
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Full Sequence
Gene start267224
Gene end556513
L-PART1 Start1
L-PART1 End46
L-PART2 Start256213
L-PART2 End266223
CDR1 Start342299
CDR1 End359316
CDR2 Start411368
CDR2 End419376
CDR3 Start528485
v_rs_start557514
v_rs_end595552

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV3-25*03_g74cGenomic Only1none12023-07-10
IGLV3-25*03_g74cGenomic Only1none22024-02-22