Sequence IGHV5-51*01
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGHV5-51*01 |
| IUIS Name | IGHV5-51*01 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Genomic and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| M99686 | Nonlocational | GenBank | 168 | 641 |
| GRCh38:CM000676.2 | Locational | GenBank | 300668 | 301141 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 216 |
| CDR1 End | 239 |
| CDR2 Start | 291 |
| CDR2 End | 314 |
| CDR3 Start | 429 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGGGTCAACCGCCATCCTCGCCCTCCTCCTGGCTGTTCTCCAAG |
| L-PART2 Start | 130 |
| L-PART2 End | 140 |
| L_PART2 | GAGTCTGTGCC |
| v_rs_start | 437 |
| v_rs_end | 474 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | TCTAAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02779 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-24 |
| Release Notes | Base annotation against GRCh38 to obtain leader sequence |
| Locus | IGH |
| Sequence Type | V |
| Gene Subgroup | 5 |
| Gene Designation | 51 |
| Allele Designation | 01 |
| Gene start | 141 |
| Gene end | 436 |
Notes
Notes are added by IARC reviewers.
| Sequence annotation is based on GRCh38:CM000676.2 |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:42 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-24 09:58:27 | Version 2 published Base annotation against GRCh38 to obtain leader sequence |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 308 | 141 |
| Gene end | 603 | 436 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 297 | 130 |
| L-PART2 End | 307 | 140 |
| CDR1 Start | 383 | 216 |
| CDR1 End | 406 | 239 |
| CDR2 Start | 458 | 291 |
| CDR2 End | 481 | 314 |
| CDR3 Start | 596 | 429 |
| v_rs_start | 604 | 437 |
| v_rs_end | 641 | 474 |
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension | ||
| Notes | changed |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGHV5-51*01 | IGHV5-51*01 | 1 | 2023-07-10 |
| IGHV5-51*01 | IGHV5-51*01 | 2 | 2024-02-24 |