Species | Human |
Species subgroup | |
Subgroup type | |
Sequence Name | IGHV3-73*02 |
IUIS Name | IGHV3-73*02 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
AB019437 | Nonlocational | GenBank | 78150 | 78650 |
HM855697 | Nonlocational | GenBank | 11 | 351 |
ON052076 | Nonlocational | GenBank | 193 | 693 |
GRCh38:CM000676.2 | Locational | GenBank | 76692 | 77192 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 236 |
CDR1 End | 259 |
CDR2 Start | 311 |
CDR2 End | 340 |
CDR3 Start | 455 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCTATTTTAAAAG |
L-PART2 Start | 150 |
L-PART2 End | 160 |
L_PART2 | GTGTCCAGTGT |
v_rs_start | 463 |
v_rs_end | 501 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACACAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02751 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 73 |
Allele Designation | 02 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:40 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
IGHV3-73*02 | IGHV3-73*02 | Genomic and rearranged | 1 | 161 | 462 | 1 | 46 | 150 | 160 | 236 | 259 | 311 | 340 | 455 | 463 | 501 | 1 | 2023-07-10 |