Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGKV4-1*02
IUIS NameIGKV4-1*02
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGKV4-1*01_a318g 27

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
MW316673NonlocationalGenBank309920

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End49
L_PART1ATGGTGTTGCAGACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTG
L-PART2 Start269
L-PART2 End279
L_PART2GTGCCTACGGG
v_rs_start585
v_rs_end612
V_HEPTAMERCACAGTG
V_NONAMERACACAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02855
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGK
Sequence TypeV
Gene Subgroup4
Gene Designation1
Allele Designation02

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316673
VDJbase example haplotype: P1_I74 (*01_A318G)
Mapped’ by haplotyping

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:45
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGKV4-1*02IGKV4-1*02Genomic and rearranged112023-07-10