| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGLV5-45*04 |
| IUIS Name | IGLV5-45*04 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged Only |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| AC245291 | Nonlocational | GenBank | 114150 | 114680 | ||
| GRCh38:NC_000022.11 | Locational | GenBank | 349939 | 350469 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 256 |
| CDR1 End | 282 |
| CDR2 Start | 334 |
| CDR2 End | 354 |
| CDR3 Start | 469 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGACTCCTCTCCTCCTCCTGTTCCTCTCTCACTGCACAG |
| L-PART2 Start | 170 |
| L-PART2 End | 180 |
| L_PART2 | GTTCCCTCTCG |
| v_rs_start | 493 |
| v_rs_end | 531 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A02940 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 1 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 5 |
| Gene Designation | 45 |
| Allele Designation | 04 |
| Gene start | 181 |
| Gene end | 492 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:48 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGLV5-45*04 | IGLV5-45*04 | 1 | 2023-07-10 |