Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGHV3-13*06
IUIS NameIGHV3-13*06
Alternative namesIGHV3-13*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeRearranged Only
MappedTrue
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGHV3-13*01_g290a_t300c 14

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
OX384051InferredGenBank1292

CDR delineation

CDR1 Start76
CDR1 End99
CDR2 Start151
CDR2 End171
CDR3 Start286

Additional Information

Sequence IDA02566
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version3
Release Date2024-01-11
Release Notes

First published version.

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation13
Allele Designationi01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

The inference IGHV3−13*01_G290A_T300C was considered at IARC meeting 116 on Feb 27th, 2023.

IGHV3−13*01_G290A_T300C has been inferred in one genotype (P1_I10) in VDJbase P1 data set. The genotype does not carry a related allele and the opposite haplotype carries a large deletion that involves IGHV3-13 (Gidoni et al. (2019) Nat Commun 10, 628. DOI: 10.1038/s41467-019-08489-3). It represents 0.23% of the total unmutated population, it is represented by 71 unmutated error-free sequences and 68 unique CDR3s of different lengths in the error-free set. Haplotyping based on allelic diversity in IGHJ6 demonstrates association of the haplotype defined by IGHJ6*03 (100:0 ratio). This allele is also inferred in multiple other data sets, two of which can be haplotyped. In both cases the inferred allele separates appropriately from IGHV3-13*05 (P1_I69) and IGHV3-13*04 (P1_I93) as determined by haplotyping.

IARC affirms the sequence as IGHV3-13*i01 at Level 1 up to and including base 319. It is acknowledged that the allele most likely carries 1 additional base, typically A, at base positions 320. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>IGHV3-13*i01
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATTGGTACTGCTGGTGACACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCAAGAG.

The locus on chromosome 14 that carries human IGHV genes is highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample OX384051
VDJbase example haplotype: P1_I10
VDJbase example haplotype: P1_I69
Mapped by P1_I10 haplotype

TR-IG NRC Report (2023-1a) allocated the IUIS name IGHV3-13*06 to this allele

The report stated:

The missing terminal nucleotide of the sequence can be confirmed as ‘A’ by reference to recent genomic sequences of Rodriguez and colleagues that are reported in the VDJbase database from eight individuals. This evidence of the terminal nucleotide is accessible via the VDJbase genomic data gene table

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 08:44:52
Version 1 published

Published by IARC on March 20th, 2023.

William Lees
2023-07-10 11:24:37
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-01-11 09:58:38
Version 3 published

First published version.

Changes from previous version

v2v3
IUIS NameIGHV3-13*06
Sequence NameIGHV3-13*i01IGHV3-13*06
Alternative namesIGHV3-13*i01
Subgroup typenone
Full Sequence
Coding Sequence
Gene end292293
Codon Frame1
Extension?TrueFalse
3' ExtensionA
5' Extension
curational_tagslikely_truncatedlikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGHV3-13*i0112023-03-20
IGHV3-13*i0122023-07-10
IGHV3-13*06IGHV3-13*0632024-01-11