Sequence IGLV7-43*01
Details
| Species | Human |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGLV7-43*01 |
| IUIS Name | IGLV7-43*01 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Genomic Only |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| Z73659 | Nonlocational | GenBank | 1 | 294 |
| D86999 | Nonlocational | GenBank | 34527 | 35003 |
| Gibson:HG01106 | Locational | GenBank | 35 | 511 |
| GRCh38:NC_000022.11 | Locational | GenBank | 368977 | 369453 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 220 |
| CDR1 End | 246 |
| CDR2 Start | 298 |
| CDR2 End | 306 |
| CDR3 Start | 415 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGACTCCTCTCTTTCTGTTCCTCCTCACTTGCTGCCCAG |
| L-PART2 Start | 134 |
| L-PART2 End | 144 |
| L_PART2 | GGTCCAATTCT |
| v_rs_start | 439 |
| v_rs_end | 477 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACATAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02947 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 1 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 7 |
| Gene Designation | 43 |
| Allele Designation | 01 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:48 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IGLV7-43*01 | IGLV7-43*01 | Genomic Only | 1 | 145 | 438 | 1 | 46 | 134 | 144 | 220 | 246 | 298 | 306 | 415 | 439 | 477 | 1 | 2023-07-10 |