Sequence IGLV5-37*03
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV5-37*03 |
| IUIS Name | IGLV5-37*03 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Genomic Only |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Observations in VDJbase
Inferred sequences in VDJbase that match this sequence:
| VDJbase Allele Name | Subjects | Sequence Match |
|---|---|---|
| IGLV5-37*01_g103a | 5 |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| Gibson:HG01258 | Locational | GenBank | 6 | 535 |
CDR delineation
| CDR1 Start | 255 |
| CDR1 End | 281 |
| CDR2 Start | 333 |
| CDR2 End | 353 |
| CDR3 Start | 468 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGACTCCTCTTCTTCTCTTGCTCCTCTCTCACTGCACAG |
| L-PART2 Start | 169 |
| L-PART2 End | 179 |
| L_PART2 | GTTCCCTCTCC |
| v_rs_start | 492 |
| v_rs_end | 530 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02935 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 5 |
| Gene Designation | 37 |
| Allele Designation | 03 |
| Gene start | 180 |
| Gene end | 491 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
No Items
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:48 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:40:09 | Version 2 published Supporting sequence and annotation updated |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 185 | 180 |
| Gene end | 496 | 491 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 174 | 169 |
| L-PART2 End | 184 | 179 |
| CDR1 Start | 260 | 255 |
| CDR1 End | 286 | 281 |
| CDR2 Start | 338 | 333 |
| CDR2 End | 358 | 353 |
| CDR3 Start | 473 | 468 |
| v_rs_start | 497 | 492 |
| v_rs_end | 535 | 530 |
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGLV5-37*03 | IGLV5-37*03 | 1 | 2023-07-10 |
| IGLV5-37*03 | IGLV5-37*03 | 2 | 2024-02-22 |