Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGHV8-51-1*03 |
IUIS Name | IGHV8-51-1*03 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | P |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
AC279152 | Nonlocational | GenBank | 19801 | 20243 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 184 |
CDR1 End | 207 |
CDR2 Start | 259 |
CDR2 End | 282 |
CDR3 Start | 397 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 52 |
L_PART1 | CTTGAGTTCCAGCACATCTTGGGAGGCCAAGCGGATGTTTGTGAAAGAAATA |
L-PART2 Start | 98 |
L-PART2 End | 108 |
L_PART2 | GTATCCAGGGT |
v_rs_start | 405 |
v_rs_end | 443 |
V_HEPTAMER | CATCGTG |
V_NONAMER | AGACAGACT |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02987 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-08-15 |
Release Notes | Sequences added following discussion at IARC meeting on 9th August 2023 |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 8-51 |
Gene Designation | 1 |
Allele Designation | 03 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-08-15 12:54:49 | Version 1 published Sequences added following discussion at IARC meeting on 9th August 2023 |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGHV8-51-1*03 | IGHV8-51-1*03 | 1 | 2023-08-15 |