Species | Homo sapiens |
Species subgroup | |
Subgroup type | |
Sequence Name | IGKV2-24*02 |
IUIS Name | IGKV2-24*02 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGKV2-24*01_t314c | 9 |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
OL352729 | Nonlocational | GenBank | 22148 | 22980 |
CDR1 Start | 582 |
CDR1 End | 614 |
CDR2 Start | 666 |
CDR2 End | 674 |
CDR3 Start | 783 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 49 |
L_PART1 | ATGAGGCTCCTTGCTCAGCTTCTGGGGCTGCTAATGCTCTGGGTCCCTG |
L-PART2 Start | 493 |
L-PART2 End | 503 |
L_PART2 | GATCCAGTGGG |
v_rs_start | 806 |
v_rs_end | 833 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02829 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 1 |
Release Date | 2023-07-10 |
Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
Locus | IGK |
Sequence Type | V |
Gene Subgroup | 2 |
Gene Designation | 24 |
Allele Designation | 02 |
Gene start | 504 |
Gene end | 805 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:44 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGKV2-24*02 | IGKV2-24*02 | 1 | 2023-07-10 |