Sequence IGKV2-24*02
Details
| Species | Human |
| Species subgroup | |
| Subgroup type | |
| Sequence Name | IGKV2-24*02 |
| IUIS Name | IGKV2-24*02 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Genomic and rearranged |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Observations in VDJbase
Inferred sequences in VDJbase that match this sequence:
| VDJbase Allele Name | Subjects | Sequence Match |
|---|---|---|
| IGKV2-24*01_t314c | 9 |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| OL352729 | Nonlocational | GenBank | 22148 | 22980 |
CDR delineation
| CDR1 Start | 582 |
| CDR1 End | 614 |
| CDR2 Start | 666 |
| CDR2 End | 674 |
| CDR3 Start | 783 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 49 |
| L_PART1 | ATGAGGCTCCTTGCTCAGCTTCTGGGGCTGCTAATGCTCTGGGTCCCTG |
| L-PART2 Start | 493 |
| L-PART2 End | 503 |
| L_PART2 | GATCCAGTGGG |
| v_rs_start | 806 |
| v_rs_end | 833 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02829 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 1 |
| Release Date | 2023-07-10 |
| Release Notes | Bulk upload of sequences for the AIRR-C Human IG germline sets |
| Locus | IGK |
| Sequence Type | V |
| Gene Subgroup | 2 |
| Gene Designation | 24 |
| Allele Designation | 02 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
No Items
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:44 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IGKV2-24*02 | IGKV2-24*02 | Genomic and rearranged | 1 | 504 | 805 | 1 | 49 | 493 | 503 | 582 | 614 | 666 | 674 | 783 | 806 | 833 | 1 | 2023-07-10 |