Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV2-14*01_g168t_t198g_c337t
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start250
CDR1 End276
CDR2 Start328
CDR2 End336
CDR3 Start445

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAG
L-PART2 Start164
L-PART2 End174
L_PART2GGTCCTGGGCC
v_rs_start472
v_rs_end510
V_HEPTAMERCACAGTG
V_NONAMERACCAAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02899
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup2
Gene Designation14
Allele Designation01_g168t_t198g_c337t

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG02059

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:46
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:33:13
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Full Sequence
Gene start216175
Gene end512471
L-PART1 Start1
L-PART1 End46
L-PART2 Start205164
L-PART2 End215174
CDR1 Start291250
CDR1 End317276
CDR2 Start369328
CDR2 End377336
CDR3 Start486445
v_rs_start513472
v_rs_end551510

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV2-14*01_g168t_t198g_c337tGenomic Only1none12023-07-10
IGLV2-14*01_g168t_t198g_c337tGenomic Only1none22024-02-22