Sequence IGLV2-14*01_g168t_t198g_c337t
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV2-14*01_g168t_t198g_c337t |
| IUIS Name | |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged Only |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 250 |
| CDR1 End | 276 |
| CDR2 Start | 328 |
| CDR2 End | 336 |
| CDR3 Start | 445 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGGCTCTGCTGCTCCTCACCCTCCTCACTCAGGGCACAG |
| L-PART2 Start | 164 |
| L-PART2 End | 174 |
| L_PART2 | GGTCCTGGGCC |
| v_rs_start | 472 |
| v_rs_end | 510 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACCAAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02899 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 2 |
| Gene Designation | 14 |
| Allele Designation | 01_g168t_t198g_c337t |
| Gene start | 175 |
| Gene end | 471 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:33:13 | Version 2 published Supporting sequence and annotation updated |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Full Sequence | ||
| Gene start | 216 | 175 |
| Gene end | 512 | 471 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 205 | 164 |
| L-PART2 End | 215 | 174 |
| CDR1 Start | 291 | 250 |
| CDR1 End | 317 | 276 |
| CDR2 Start | 369 | 328 |
| CDR2 End | 377 | 336 |
| CDR3 Start | 486 | 445 |
| v_rs_start | 513 | 472 |
| v_rs_end | 551 | 510 |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGLV2-14*01_g168t_t198g_c337t | 1 | 2023-07-10 | |
| IGLV2-14*01_g168t_t198g_c337t | 2 | 2024-02-22 |