The inference of TRBV5-6*01_T284G was considered at IARC meeting 115 on February 9th, 2023

TRBV5−6*01_T284G (substitution: L95W) has been inferred in four genotypes in the VDJbase P4 data set, including in VDJbase P4_I12_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV5-6*01. No other gene in the IMGT database is highly similar to these alleles of TRBV5-6. The novel allele is the lesser expressed allele in the repertoire (35% allelic frequency; 0.43% of the total error-free population). It is represented by 122 error-free sequences and 118 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates perfect separation from TRBV5-6*01. IARC affirms the sequence as TRBV5-6*i01 at Level 1 up to and including base 324. It is acknowledged that the allele most likely carries 1 additional base, typically G, at base position 325. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>TRBV5-6*i01
GACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCATGACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCGATTCTCAGGTCACCAGTTCCCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTGGCTGGGGGACTCGGCCCTCTATCTCTGTGCCAGCAGCTTG.

TR loci might be highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.