Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameTRBV5-6*i01
IUIS Name
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityF
Inference TypeRearranged Only
Mapped
Paralogs
Paralog Rep

Evidence

The table below lists submissions to IARC , and the inferences within them, on which this IARC-affirmed sequence is based.

'Sequence Match' indicates whether the inference exactly matches the sequence, and clicking on the tick or cross will provide an alignment. Mismatches may be caused, for example, by the inclusion of leader sequences, or nucleotides in the inference which do not in IARC's opinion have sufficient evidence for inclusion in the sequence.

Submission IDAccession NoSubject IDGenotype NameSequence NameSequence Match
S00036 OW166724CI13P4_I12_S1_ogrdb_reportTRBV5-6*01_T284G

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
TRBV5-6*01_t284g 6

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

No Items

CDR delineation

CDR1 Start79
CDR1 End93
CDR2 Start145
CDR2 End162
CDR3 Start274

Non-Core Regions

Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Additional Information

Sequence IDA02568
CuratorMats Ohlin
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden
Version1
Release Date2023-03-20
Release Notes

Published by IARC on March 20, 2023.

LocusTRB
Sequence TypeV
Gene Subgroup5
Gene Designation6
Allele Designationi01
Gene start1
Gene end285

Acknowledgements

Individuals acknowledged as contributing to this sequence:

NameInstitutionORCID ID
William LeesBirkbeck College, University of London, Malet Street, London

Notes

Notes are added by IARC reviewers.

The inference of TRBV5-6*01_T284G was considered at IARC meeting 115 on February 9th, 2023

TRBV5−6*01_T284G (substitution: L95W) has been inferred in four genotypes in the VDJbase P4 data set, including in VDJbase P4_I12_S1, a haplotypable data set (based on heterozygocity in TRBJ1-6). The genotype is also implied to carry TRBV5-6*01. No other gene in the IMGT database is highly similar to these alleles of TRBV5-6. The novel allele is the lesser expressed allele in the repertoire (35% allelic frequency; 0.43% of the total error-free population). It is represented by 122 error-free sequences and 118 unique CDR3s in the error-free set. Haplotyping based on allelic diversity in TRBJ1-6 demonstrates perfect separation from TRBV5-6*01. IARC affirms the sequence as TRBV5-6*i01 at Level 1 up to and including base 324. It is acknowledged that the allele most likely carries 1 additional base, typically G, at base position 325. Trailing “.” indicates IARC’s opinion that the sequence is likely to contain additional 3’-nucleotides for which there is insufficient evidence to make an affirmation. For use in a reference germline gene set, IARC recommends the use of the expected full length sequence.

>TRBV5-6*i01
GACGCTGGAGTCACCCAAAGTCCCACACACCTGATCAAAACGAGAGGACAGCAAGTGACTCTGAGATGCTCTCCTAAGTCTGGGCATGACACTGTGTCCTGGTACCAACAGGCCCTGGGTCAGGGGCCCCAGTTTATCTTTCAGTATTATGAGGAGGAAGAGAGACAGAGAGGCAACTTCCCTGATCGATTCTCAGGTCACCAGTTCCCTAACTATAGCTCTGAGCTGAATGTGAACGCCTTGTGGCTGGGGGACTCGGCCCTCTATCTCTGTGCCAGCAGCTTG.

TR loci might be highly complex. Genes may be duplicated or deleted, and identical sequences may be found in more than one gene. The name (with an “i” allele designation) of an inferred allele does not imply that its precise genetic location is known. It just relates to the most similar allele presently found in the IMGT database, or to the gene with the lowest alphanumeric value, should alleles of multiple genes be equally matched to the novel allele in question. No other highly similar genes have been described.

Attachments

Supplementary Files
 TRBV5-6*i01_meeting 115.pdf

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2023-03-20 09:06:12
Version 1 published

Published by IARC on March 20, 2023.

Versions

All published versions of this sequence.

Sequence NameIUIS NameVersionDate
TRBV5-6*i0112023-03-20