Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGLV1-44*03
IUIS NameIGLV1-44*03
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedFalse
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGLV1-44*01_c215t 1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
MW316668NonlocationalGenBank87593

CDR delineation

CDR1 Start248
CDR1 End271
CDR2 Start323
CDR2 End331
CDR3 Start440

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCAGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAG
L-PART2 Start162
L-PART2 End172
L_PART2GGTCCTGGGCC
v_rs_start469
v_rs_end507
V_HEPTAMERCACAGTG
V_NONAMERACAAGAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02886
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version1
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGL
Sequence TypeV
Gene Subgroup1
Gene Designation44
Allele Designation03

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316668

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:45
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV1-44*03IGLV1-44*03Genomic Only112023-07-10