Details


Species	Human
Species subgroup
Subgroup type	none
Sequence Name	IGLV10-54*04
IUIS Name	IGLV10-54*04
Alternative names	IGLV10-54*i01
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Genomic and rearranged
Mapped	False
Paralogs
Paralog Rep	False

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGLV10-54*01_a228c	24

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
MW316678	Nonlocational	GenBank	148	651
Gibson:HG02061	Locational	GenBank	1	504

CDR delineation


CDR1 Start	245
CDR1 End	268
CDR2 Start	320
CDR2 End	328
CDR3 Start	437

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start	1
L-PART1 End	46
L_PART1	ATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAG
L-PART2 Start	159
L-PART2 End	169
L_PART2	TGTCAGTGGTC
v_rs_start	466
v_rs_end	504
V_HEPTAMER	CACAGTG
V_NONAMER	ATAAAAACT

Extension


3' Extension	CA
3' start	340
3' end	341
5' start
5' end

Additional Information


Sequence ID	A00055
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	3
Release Date	2024-02-22
Release Notes	Supporting sequence and annotation updated
Locus	IGL
Sequence Type	V
Gene Subgroup	10
Gene Designation	54
Allele Designation	04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


The sequence was first affirmed at IARC Meeting 53 on April 14th 2020, where it was noted: “The sequence was seen in 1.79% of all unmutated rearrangements, with 11279 sequences including 2138 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV10-54*01 allele was also present in the genotype, at a similar frequency (1.77% of all unmutated sequences; 7826 sequences; 2117 unmutated sequences). Haplotype data is unavailable. Plots of the final 3’ nucleotides showed a high level of variability, making it impossible to determine the final three nucleotides with certainty. The sequence, up to and including nucleotide 339, was affirmed as a Level 1 sequence. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.” Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample MW316678

The sequence was first affirmed at IARC Meeting 53 on April 14th 2020, where it was noted:

“The sequence was seen in 1.79% of all unmutated rearrangements, with 11279 sequences including 2138 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV10-54*01 allele was also present in the genotype, at a similar frequency (1.77% of all unmutated sequences; 7826 sequences; 2117 unmutated sequences). Haplotype data is unavailable. Plots of the final 3’ nucleotides showed a high level of variability, making it impossible to determine the final three nucleotides with certainty. The sequence, up to and including nucleotide 339, was affirmed as a Level 1 sequence. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.”

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316678

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Andrew Collins 2020-07-30 12:58:46	Version 1 published Submission published by IARC on July 30th 2020.


Mats Ohlin 2021-04-29 22:33:15	*IMGT Name updated to IGLV10-5404** IMGT Name updated.


William Lees 2023-07-10 11:24:46	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets


William Lees 2024-02-22 15:28:54	Version 3 published Supporting sequence and annotation updated

Changes from previous version

	v2	v3
Subgroup type		none
Full Sequence
Gene start	317	170
Gene end	610	463
L-PART1 Start		1
L-PART1 End		46
L-PART2 Start	306	159
L-PART2 End	316	169
CDR1 Start	392	245
CDR1 End	415	268
CDR2 Start	467	320
CDR2 End	475	328
CDR3 Start	584	437
v_rs_start	613	466
v_rs_end	651	504
Codon Frame		1
3' start		340
3' end		341

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Alternative names	Inference Type	Affirmation Level	Subgroup type	Gene start	Gene end	L-PART1 Start	L-PART1 End	L-PART2 Start	L-PART2 End	CDR1 Start	CDR1 End	CDR2 Start	CDR2 End	CDR3 Start	v_rs_start	v_rs_end	Codon Frame	Version	Date
IGLV10-54*i01	IGLV10-54*04		Rearranged Only	1		1	294					76	99	151	159	268				1	2020-07-30
IGLV10-54*04	IGLV10-54*04	IGLV10-54*i01	Genomic and rearranged	1		317	610			306	316	392	415	467	475	584	613	651		2	2023-07-10
IGLV10-54*04	IGLV10-54*04	IGLV10-54*i01	Genomic and rearranged	1	none	170	463	1	46	159	169	245	268	320	328	437	466	504	1	3	2024-02-22