Details

SpeciesHomo sapiens
Species subgroup
Subgroup typenone
Sequence NameIGLV10-54*04
IUIS NameIGLV10-54*04
Alternative namesIGLV10-54*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeUnrearranged and Rearranged
MappedFalse
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEndCoding SequenceSC Coding Sequence
MW316678NonlocationalGenBank148651
Gibson:HG02061LocationalGenBank1504

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start245
CDR1 End268
CDR2 Start320
CDR2 End328
CDR3 Start437

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAG
L-PART2 Start159
L-PART2 End169
L_PART2TGTCAGTGGTC
v_rs_start466
v_rs_end504
V_HEPTAMERCACAGTG
V_NONAMERATAAAAACT
Exon 1 Start
Exon 1 End
Exon 2 Start
Exon 2 End
Exon 3 Start
Exon 3 End
Exon 4 Start
Exon 4 End
Exon 5 Start
Exon 5 End
Exon 6 Start
Exon 6 End
Exon 7 Start
Exon 7 End
Exon 8 Start
Exon 8 End
Exon 9 Start
Exon 9 End
UTR 3' Start
UTR 3' End

Extension

3' ExtensionCA
3' start340
3' end341
5' start
5' end

Additional Information

Sequence IDA00055
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version3
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup10
Gene Designation54
Allele Designation04
Gene start170
Gene end463

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

The sequence was first affirmed at IARC Meeting 53 on April 14th 2020, where it was noted:

“The sequence was seen in 1.79% of all unmutated rearrangements, with 11279 sequences including 2138 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV10-54*01 allele was also present in the genotype, at a similar frequency (1.77% of all unmutated sequences; 7826 sequences; 2117 unmutated sequences). Haplotype data is unavailable. Plots of the final 3’ nucleotides showed a high level of variability, making it impossible to determine the final three nucleotides with certainty. The sequence, up to and including nucleotide 339, was affirmed as a Level 1 sequence. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.”

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MW316678

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Andrew Collins
2020-07-30 12:58:46
Version 1 published

Submission published by IARC on July 30th 2020.

Mats Ohlin
2021-04-29 22:33:15
IMGT Name updated to IGLV10-54*04

IMGT Name updated.

William Lees
2023-07-10 11:24:46
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:28:54
Version 3 published

Supporting sequence and annotation updated

Changes from previous version

v2v3
Subgroup typenone
Full Sequence
Gene start317170
Gene end610463
L-PART1 Start1
L-PART1 End46
L-PART2 Start306159
L-PART2 End316169
CDR1 Start392245
CDR1 End415268
CDR2 Start467320
CDR2 End475328
CDR3 Start584437
v_rs_start613466
v_rs_end651504
Codon Frame1
3' start340
3' end341

Versions

All published versions of this sequence.

Sequence NameIMGT NameVersionDate
IGLV10-54*i01IGLV10-54*0412020-07-30
IGLV10-54*04IGLV10-54*0422023-07-10
IGLV10-54*04IGLV10-54*0432024-02-22