Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV10-54*04 |
IUIS Name | IGLV10-54*04 |
Alternative names | IGLV10-54*i01 |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic and rearranged |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Inferred sequences in VDJbase that match this sequence:
VDJbase Allele Name | Subjects | Sequence Match |
---|---|---|
IGLV10-54*01_a228c | 24 |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
MW316678 | Nonlocational | GenBank | 148 | 651 |
Gibson:HG02061 | Locational | GenBank | 1 | 504 |
CDR1 Start | 245 |
CDR1 End | 268 |
CDR2 Start | 320 |
CDR2 End | 328 |
CDR3 Start | 437 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGCCCTGGGCTCTGCTCCTCCTGACCCTCCTCACTCACTCTGCAG |
L-PART2 Start | 159 |
L-PART2 End | 169 |
L_PART2 | TGTCAGTGGTC |
v_rs_start | 466 |
v_rs_end | 504 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ATAAAAACT |
3' Extension | CA |
3' start | 340 |
3' end | 341 |
5' start | |
5' end |
Sequence ID | A00055 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 3 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 10 |
Gene Designation | 54 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
The sequence was first affirmed at IARC Meeting 53 on April 14th 2020, where it was noted: “The sequence was seen in 1.79% of all unmutated rearrangements, with 11279 sequences including 2138 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. The IGLV10-54*01 allele was also present in the genotype, at a similar frequency (1.77% of all unmutated sequences; 7826 sequences; 2117 unmutated sequences). Haplotype data is unavailable. Plots of the final 3’ nucleotides showed a high level of variability, making it impossible to determine the final three nucleotides with certainty. The sequence, up to and including nucleotide 339, was affirmed as a Level 1 sequence. Uncertainty regarding nucleotides 340-341 will be indicated in IARC and OGRDB publications by two dots at the end of the affirmed sequence.” Additional information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
Andrew Collins 2020-07-30 12:58:46 | Version 1 published Submission published by IARC on July 30th 2020. |
Mats Ohlin 2021-04-29 22:33:15 | IMGT Name updated to IGLV10-54*04 IMGT Name updated. |
William Lees 2023-07-10 11:24:46 | Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:28:54 | Version 3 published Supporting sequence and annotation updated |
v2 | v3 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 317 | 170 |
Gene end | 610 | 463 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 306 | 159 |
L-PART2 End | 316 | 169 |
CDR1 Start | 392 | 245 |
CDR1 End | 415 | 268 |
CDR2 Start | 467 | 320 |
CDR2 End | 475 | 328 |
CDR3 Start | 584 | 437 |
v_rs_start | 613 | 466 |
v_rs_end | 651 | 504 |
Codon Frame | 1 | |
3' start | 340 | |
3' end | 341 |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV10-54*i01 | IGLV10-54*04 | 1 | 2020-07-30 |
IGLV10-54*04 | IGLV10-54*04 | 2 | 2023-07-10 |
IGLV10-54*04 | IGLV10-54*04 | 3 | 2024-02-22 |