Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV3-12*01 |
IUIS Name | IGLV3-12*01 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
Z73658 | Nonlocational | GenBank | 1 | 290 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 536 |
CDR1 End | 553 |
CDR2 Start | 605 |
CDR2 End | 613 |
CDR3 Start | 722 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ACGGCCTGGACCCCTCTCCTCCTCGGCCTCCTCGCTCACTGCACAG |
L-PART2 Start | 450 |
L-PART2 End | 460 |
L_PART2 | GCTCTGCGACC |
v_rs_start | 751 |
v_rs_end | 789 |
V_HEPTAMER | CACGGTG |
V_NONAMER | ACAAAAACA |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02912 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 12 |
Allele Designation | 01 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:36:15 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 470 | 461 |
Gene end | 759 | 750 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 459 | 450 |
L-PART2 End | 469 | 460 |
CDR1 Start | 545 | 536 |
CDR1 End | 562 | 553 |
CDR2 Start | 614 | 605 |
CDR2 End | 622 | 613 |
CDR3 Start | 731 | 722 |
v_rs_start | 760 | 751 |
v_rs_end | 798 | 789 |
Codon Frame | 1 | |
3' Extension | ||
5' Extension |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV3-12*01 | IGLV3-12*01 | 1 | 2023-07-10 |
IGLV3-12*01 | IGLV3-12*01 | 2 | 2024-02-22 |