Sequence IGLV3-12*01
Details
| Species | Human |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV3-12*01 |
| IUIS Name | IGLV3-12*01 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Genomic Only |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| Z73658 | Nonlocational | GenBank | 1 | 290 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 536 |
| CDR1 End | 553 |
| CDR2 Start | 605 |
| CDR2 End | 613 |
| CDR3 Start | 722 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ACGGCCTGGACCCCTCTCCTCCTCGGCCTCCTCGCTCACTGCACAG |
| L-PART2 Start | 450 |
| L-PART2 End | 460 |
| L_PART2 | GCTCTGCGACC |
| v_rs_start | 751 |
| v_rs_end | 789 |
| V_HEPTAMER | CACGGTG |
| V_NONAMER | ACAAAAACA |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02912 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 12 |
| Allele Designation | 01 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:36:15 | Version 2 published Supporting sequence and annotation updated |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 470 | 461 |
| Gene end | 759 | 750 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 459 | 450 |
| L-PART2 End | 469 | 460 |
| CDR1 Start | 545 | 536 |
| CDR1 End | 562 | 553 |
| CDR2 Start | 614 | 605 |
| CDR2 End | 622 | 613 |
| CDR3 Start | 731 | 722 |
| v_rs_start | 760 | 751 |
| v_rs_end | 798 | 789 |
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Alternative names | Inference Type | Affirmation Level | Species subgroup | Subgroup type | Gene start | Gene end | UTR 5' Start | UTR 5' End | L-PART1 Start | L-PART1 End | L-PART2 Start | L-PART2 End | CDR1 Start | CDR1 End | CDR2 Start | CDR2 End | CDR3 Start | v_rs_start | v_rs_end | d_rs_3_prime_start | d_rs_3_prime_end | d_rs_5_prime_start | d_rs_5_prime_end | j_rs_start | j_rs_end | Codon Frame | Version | Date |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IGLV3-12*01 | IGLV3-12*01 | Genomic Only | 1 | 470 | 759 | 459 | 469 | 545 | 562 | 614 | 622 | 731 | 760 | 798 | 1 | 2023-07-10 | ||||||||||||||
| IGLV3-12*01 | IGLV3-12*01 | Genomic Only | 1 | none | 461 | 750 | 1 | 46 | 450 | 460 | 536 | 553 | 605 | 613 | 722 | 751 | 789 | 1 | 2 | 2024-02-22 |