Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGLV1-47*01
IUIS NameIGLV1-47*01
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic Only
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
Z73663NonlocationalGenBank1296

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start248
CDR1 End271
CDR2 Start323
CDR2 End331
CDR3 Start440

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGCCGGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAG
L-PART2 Start162
L-PART2 End172
L_PART2GGTCCTGGGCC
v_rs_start469
v_rs_end507
V_HEPTAMERCACAGTG
V_NONAMERACAAGAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02887
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-22
Release Notes

Supporting sequence and annotation updated

LocusIGL
Sequence TypeV
Gene Subgroup1
Gene Designation47
Allele Designation01

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample Gibson:HG01106

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:46
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-22 15:27:14
Version 2 published

Supporting sequence and annotation updated

Changes from previous version

v1v2
Subgroup typenone
Full Sequence
Gene start229173
Gene end524468
L-PART1 Start1
L-PART1 End46
L-PART2 Start218162
L-PART2 End228172
CDR1 Start304248
CDR1 End327271
CDR2 Start379323
CDR2 End387331
CDR3 Start496440
v_rs_start525469
v_rs_end563507
Codon Frame1
3' Extension
5' Extension

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGLV1-47*01IGLV1-47*01Genomic Only112023-07-10
IGLV1-47*01IGLV1-47*01Genomic Only1none22024-02-22