| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV1-47*01 |
| IUIS Name | IGLV1-47*01 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged Only |
| Mapped | True |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | Coding Sequence | SC Coding Sequence |
|---|---|---|---|---|---|---|
| Z73663 | Nonlocational | GenBank | 1 | 296 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 248 |
| CDR1 End | 271 |
| CDR2 Start | 323 |
| CDR2 End | 331 |
| CDR3 Start | 440 |
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCGGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAG |
| L-PART2 Start | 162 |
| L-PART2 End | 172 |
| L_PART2 | GGTCCTGGGCC |
| v_rs_start | 469 |
| v_rs_end | 507 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAAGAACC |
| Exon 1 Start | |
| Exon 1 End | |
| Exon 2 Start | |
| Exon 2 End | |
| Exon 3 Start | |
| Exon 3 End | |
| Exon 4 Start | |
| Exon 4 End | |
| Exon 5 Start | |
| Exon 5 End | |
| Exon 6 Start | |
| Exon 6 End | |
| Exon 7 Start | |
| Exon 7 End | |
| Exon 8 Start | |
| Exon 8 End | |
| Exon 9 Start | |
| Exon 9 End | |
| UTR 3' Start | |
| UTR 3' End |
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
| Sequence ID | A02887 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 1 |
| Gene Designation | 47 |
| Allele Designation | 01 |
| Gene start | 173 |
| Gene end | 468 |
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:27:14 | Version 2 published Supporting sequence and annotation updated |
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 229 | 173 |
| Gene end | 524 | 468 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 218 | 162 |
| L-PART2 End | 228 | 172 |
| CDR1 Start | 304 | 248 |
| CDR1 End | 327 | 271 |
| CDR2 Start | 379 | 323 |
| CDR2 End | 387 | 331 |
| CDR3 Start | 496 | 440 |
| v_rs_start | 525 | 469 |
| v_rs_end | 563 | 507 |
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension |
All published versions of this sequence.
| Sequence Name | IUIS Name | Version | Date |
|---|---|---|---|
| IGLV1-47*01 | IGLV1-47*01 | 1 | 2023-07-10 |
| IGLV1-47*01 | IGLV1-47*01 | 2 | 2024-02-22 |