| Species | Homo sapiens | 
| Species subgroup | |
| Subgroup type | none | 
| Sequence Name | IGLV3-19*02 | 
| IUIS Name | IGLV3-19*02 | 
| Alternative names | |
| Affirmation Level | 1 | 
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF | 
| Inference Type | Unrearranged Only | 
| Mapped | False | 
| Paralogs | |
| Paralog Rep | False | 
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End | 
|---|---|---|---|---|
| Gibson:NA18555 | Locational | GenBank | 41 | 572 | 
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
| CDR1 Start | 279 | 
| CDR1 End | 296 | 
| CDR2 Start | 348 | 
| CDR2 End | 356 | 
| CDR3 Start | 465 | 
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 | 
| L-PART1 End | 46 | 
| L_PART1 | ATGGCCTGGACCCCTCTCTGGCTTACTCTCCTCACTCTTTGCATAG | 
| L-PART2 Start | 193 | 
| L-PART2 End | 203 | 
| L_PART2 | GTTCTGTGGTT | 
| v_rs_start | 494 | 
| v_rs_end | 532 | 
| V_HEPTAMER | CACAGTG | 
| V_NONAMER | ACAGAAACC | 
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end | 
| Sequence ID | A02918 | 
| Curator | William Lees | 
| Curator address | Birkbeck College, University of London, Malet Street, London | 
| Version | 2 | 
| Release Date | 2024-02-22 | 
| Release Notes | Supporting sequence and annotation updated | 
| Locus | IGL | 
| Sequence Type | V | 
| Gene Subgroup | 3 | 
| Gene Designation | 19 | 
| Allele Designation | 02 | 
| Gene start | 204 | 
| Gene end | 493 | 
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: | 
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets | 
| William Lees 2024-02-22 15:36:56 | Version 2 published Supporting sequence and annotation updated | 
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 244 | 204 | 
| Gene end | 533 | 493 | 
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 233 | 193 | 
| L-PART2 End | 243 | 203 | 
| CDR1 Start | 319 | 279 | 
| CDR1 End | 336 | 296 | 
| CDR2 Start | 388 | 348 | 
| CDR2 End | 396 | 356 | 
| CDR3 Start | 505 | 465 | 
| v_rs_start | 534 | 494 | 
| v_rs_end | 572 | 532 | 
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension | 
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date | 
|---|---|---|---|
| IGLV3-19*02 | IGLV3-19*02 | 1 | 2023-07-10 | 
| IGLV3-19*02 | IGLV3-19*02 | 2 | 2024-02-22 |