Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV3-19*02 |
IUIS Name | IGLV3-19*02 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Unrearranged Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
Gibson:NA18555 | Locational | GenBank | 41 | 572 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 279 |
CDR1 End | 296 |
CDR2 Start | 348 |
CDR2 End | 356 |
CDR3 Start | 465 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGACCCCTCTCTGGCTTACTCTCCTCACTCTTTGCATAG |
L-PART2 Start | 193 |
L-PART2 End | 203 |
L_PART2 | GTTCTGTGGTT |
v_rs_start | 494 |
v_rs_end | 532 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACAGAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02918 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 3 |
Gene Designation | 19 |
Allele Designation | 02 |
Gene start | 204 |
Gene end | 493 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:36:56 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 244 | 204 |
Gene end | 533 | 493 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 233 | 193 |
L-PART2 End | 243 | 203 |
CDR1 Start | 319 | 279 |
CDR1 End | 336 | 296 |
CDR2 Start | 388 | 348 |
CDR2 End | 396 | 356 |
CDR3 Start | 505 | 465 |
v_rs_start | 534 | 494 |
v_rs_end | 572 | 532 |
Codon Frame | 1 | |
3' Extension | ||
5' Extension |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV3-19*02 | IGLV3-19*02 | 1 | 2023-07-10 |
IGLV3-19*02 | IGLV3-19*02 | 2 | 2024-02-22 |