Sequence IGLV3-19*02
Details
| Species | Homo sapiens |
| Species subgroup | |
| Subgroup type | none |
| Sequence Name | IGLV3-19*02 |
| IUIS Name | IGLV3-19*02 |
| Alternative names | |
| Affirmation Level | 1 |
| Full Sequence | |
| Coding Sequence | |
| Functionality | ORF |
| Inference Type | Unrearranged Only |
| Mapped | False |
| Paralogs | |
| Paralog Rep | False |
Un-rearranged Observations
Un-rearranged sequence observations that support this sequence:
| Accession | Type | Repository | Start | End |
|---|---|---|---|---|
| Gibson:NA18555 | Locational | GenBank | 41 | 572 |
Observations in AIRR-seq Repertoires
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR delineation
| CDR1 Start | 279 |
| CDR1 End | 296 |
| CDR2 Start | 348 |
| CDR2 End | 356 |
| CDR3 Start | 465 |
Non-Core Regions
| UTR 5' Start | |
| UTR 5' End | |
| L-PART1 Start | 1 |
| L-PART1 End | 46 |
| L_PART1 | ATGGCCTGGACCCCTCTCTGGCTTACTCTCCTCACTCTTTGCATAG |
| L-PART2 Start | 193 |
| L-PART2 End | 203 |
| L_PART2 | GTTCTGTGGTT |
| v_rs_start | 494 |
| v_rs_end | 532 |
| V_HEPTAMER | CACAGTG |
| V_NONAMER | ACAGAAACC |
Extension
| 3' Extension | |
| 3' start | |
| 3' end | |
| 5' start | |
| 5' end |
Additional Information
| Sequence ID | A02918 |
| Curator | William Lees |
| Curator address | Birkbeck College, University of London, Malet Street, London |
| Version | 2 |
| Release Date | 2024-02-22 |
| Release Notes | Supporting sequence and annotation updated |
| Locus | IGL |
| Sequence Type | V |
| Gene Subgroup | 3 |
| Gene Designation | 19 |
| Allele Designation | 02 |
| Gene start | 204 |
| Gene end | 493 |
Notes
Notes are added by IARC reviewers.
| Information for this sequence was imported into OGRDB via bulk update with the following notes: |
Attachments
History
History logs the times and reasons for the publication of each version of this sequence.
| William Lees 2023-07-10 11:24:47 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
| William Lees 2024-02-22 15:36:56 | Version 2 published Supporting sequence and annotation updated |
Changes from previous version
| v1 | v2 | |
|---|---|---|
| Subgroup type | none | |
| Full Sequence | ||
| Gene start | 244 | 204 |
| Gene end | 533 | 493 |
| L-PART1 Start | 1 | |
| L-PART1 End | 46 | |
| L-PART2 Start | 233 | 193 |
| L-PART2 End | 243 | 203 |
| CDR1 Start | 319 | 279 |
| CDR1 End | 336 | 296 |
| CDR2 Start | 388 | 348 |
| CDR2 End | 396 | 356 |
| CDR3 Start | 505 | 465 |
| v_rs_start | 534 | 494 |
| v_rs_end | 572 | 532 |
| Codon Frame | 1 | |
| 3' Extension | ||
| 5' Extension |
Versions
All published versions of this sequence.
| Sequence Name | IMGT Name | Version | Date |
|---|---|---|---|
| IGLV3-19*02 | IGLV3-19*02 | 1 | 2023-07-10 |
| IGLV3-19*02 | IGLV3-19*02 | 2 | 2024-02-22 |