Details

SpeciesHuman
Species subgroup
Subgroup type
Sequence NameIGHV3-9*04
IUIS NameIGHV3-9*04
Alternative namesIGHV3-9*i01
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele NameSubjectsSequence Match
IGHV3-9*01_t307c 1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
MN337621NonlocationalGenBank78372
OU596108InferredGenBank1295

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start
L-PART1 End
L_PART1
L-PART2 Start
L-PART2 End
L_PART2
v_rs_start
v_rs_end
V_HEPTAMER
V_NONAMER

Extension

3' ExtensionATA
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA00069
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2023-07-10
Release Notes

Bulk upload of sequences for the AIRR-C Human IG germline sets

LocusIGH
Sequence TypeV
Gene Subgroup3
Gene Designation9
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-9*01_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-9*01 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18, 2021):
IGHV3-9*01_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-9*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-9*01_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-9*01 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9*i01.

>IGHV3-9*i01
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MN337621
VDJbase example haplotype: P1_I86
Mapped by P1_I86 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

Mats Ohlin
2021-11-01 22:49:26
Version 1 published

Submission published by IARC on November 1st, 2021

Mats Ohlin
2021-11-17 15:25:07
IMGT Name updated to IGHV3-9*04

IMGT Name updated.

William Lees
2023-07-10 11:24:40
Version 2 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

v1v2
CuratorMats OhlinWilliam Lees
Curator addressDept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, SwedenBirkbeck College, University of London, Malet Street, London
Sequence NameIGHV3-9*i01IGHV3-9*04
Alternative namesIGHV3-9*i01
Chromosome14
MappedTrue
FunctionalityFORF
Inference TypeRearranged OnlyGenomic and rearranged
Subgroup typenone
Allele Designationi0104
Full Sequence
Gene start1
Gene end295
Codon Frame1
Paralog RepFalse
Extension?FalseTrue
3' ExtensionATA
5' Extension
curational_tagsnonelikely_full-length
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV3-9*i01IGHV3-9*04Rearranged Only1none12021-11-01
IGHV3-9*04IGHV3-9*04IGHV3-9*i01Genomic and rearranged122023-07-10