Details


Species	Homo sapiens
Species subgroup
Subgroup type
Sequence Name	IGHV3-9*04
IUIS Name	IGHV3-9*04
Alternative names	IGHV3-9*i01
Affirmation Level	1
Full Sequence
Coding Sequence
Functionality	ORF
Inference Type	Genomic and rearranged
Mapped	True
Paralogs
Paralog Rep	False

Observations in VDJbase

Inferred sequences in VDJbase that match this sequence:

VDJbase Allele Name	Subjects	Sequence Match
IGHV3-9*01_t307c	1

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

Accession	Type	Repository	Start	End
MN337621	Nonlocational	GenBank	78	372
OU596108	Inferred	GenBank	1	295

CDR delineation


CDR1 Start	76
CDR1 End	99
CDR2 Start	151
CDR2 End	174
CDR3 Start	289

Non-Core Regions


UTR 5' Start
UTR 5' End
L-PART1 Start
L-PART1 End
L_PART1
L-PART2 Start
L-PART2 End
L_PART2
v_rs_start
v_rs_end
V_HEPTAMER
V_NONAMER

Extension


3' Extension	ATA
3' start
3' end
5' start
5' end

Additional Information


Sequence ID	A00069
Curator	William Lees
Curator address	Birkbeck College, University of London, Malet Street, London
Version	2
Release Date	2023-07-10
Release Notes	Bulk upload of sequences for the AIRR-C Human IG germline sets
Locus	IGH
Sequence Type	V
Gene Subgroup	3
Gene Designation	9
Allele Designation	04
Gene start	1
Gene end	295

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.


IARC meeting 62 (Nov 3rd, 2020): The meeting considered the inference of the variant IGHV3-901_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-901 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes. IARC meeting 83 (Oct 18, 2021): IGHV3-901_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-901. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-901_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-901 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9i01. >IGHV3-9i01 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG… Additional information for this sequence was imported into OGRDB via bulk update with the following notes: Sequence annotation is based on Genbank sample MN337621 VDJbase example haplotype: P1_I86 Mapped by P1_I86 haplotype

IARC meeting 62 (Nov 3rd, 2020):
The meeting considered the inference of the variant IGHV3-9*01_t307c, in the VDJbase dataset of sample P1_I86_S1. The sequence was seen in 1.29% of all unmutated rearrangements, with 433 sequences including 368 perfect matches to the inferred allele. There was abundant variation in the CDR3 regions of the aligned sequences. IGHV3-9*01 was also present in the genotype, at a similar frequency (2.25% of all unmutated sequences, 748 sequences, 641 unmutated sequences). Haplotyping data showed almost perfect separation of the assigned alleles. Plots of the final 3’ nucleotides of the inference were unavailable. The inferred sequence was tentatively affirmed as a Level 1 sequence. The final 3’ nucleotides will be considered at a later date, at which time the affirmed sequence will be noted in the IARC minutes.

IARC meeting 83 (Oct 18, 2021):
IGHV3-9*01_T307C was inferred in subject S82 (P1_I86_S1; ERR2567259), a genotype that also expressed IGHV3-9*01. This inference has previously been pre-assessed at IARC meeting 62 (https://www.antibodysociety.org/wordpress/wp-content/uploads/2021/04/Meeting-62-3_11_20-minutes.pdf). IGHV3-9*01_T307C was well expressed, represented by 453 sequences, allelic frequency 36%, represented 1.6% of the unmutated population, and had 373 unique CDR3s in the unmutated population. It showed a haplotype ratio (based on association with alleles of IGHJ6) of 100:0 while IGHV3-9*01 showed a ratio of 1:99. IARC affirms the sequence up to and including base 319 as a level 1 sequence. It is acknowledged that the allele most likely carries 3 additional bases, typically ATA at base position 320-322. The trailing “…” indicates IARC’s opinion that the sequence is likely to contain three additional 3’ nucleotides for which there is insufficient evidence to make an affirmation. The allele is given the name IGHV3-9*i01.

>IGHV3-9*i01
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTGATGATTATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATTAGTTGGAATAGTGGTAGCATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATCACTGTGCAAAAG…

Additional information for this sequence was imported into OGRDB via bulk update with the following notes:
Sequence annotation is based on Genbank sample MN337621
VDJbase example haplotype: P1_I86
Mapped by P1_I86 haplotype

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.


Mats Ohlin 2021-11-01 22:49:26	Version 1 published Submission published by IARC on November 1st, 2021


Mats Ohlin 2021-11-17 15:25:07	*IMGT Name updated to IGHV3-904** IMGT Name updated.


William Lees 2023-07-10 11:24:40	Version 2 published Bulk upload of sequences for the AIRR-C Human IG germline sets

Changes from previous version

	v1	v2
Curator	Mats Ohlin	William Lees
Curator address	Dept. of Immunotechnology, Lund University, Medicon Village building 406, S-22381 Lund, Sweden	Birkbeck College, University of London, Malet Street, London
Sequence Name	IGHV3-9*i01	IGHV3-9*04
Alternative names		IGHV3-9*i01
Chromosome		14
Mapped		True
Functionality	F	ORF
Inference Type	Rearranged Only	Genomic and rearranged
Subgroup type	none
Allele Designation	i01	04
Full Sequence
Codon Frame	1
Paralog Rep		False
Extension?	False	True
3' Extension		ATA
5' Extension
curational_tags	none	likely_full-length
Notes		changed

Versions

All published versions of this sequence.

Sequence Name	IMGT Name	Version	Date
IGHV3-9*i01	IGHV3-9*04	1	2021-11-01
IGHV3-9*04	IGHV3-9*04	2	2023-07-10