Details

SpeciesHuman
Species subgroup
Subgroup typenone
Sequence NameIGHV1-2*04
IUIS NameIGHV1-2*04
Alternative names
Affirmation Level1
Full Sequence
Coding Sequence
FunctionalityORF
Inference TypeGenomic and rearranged
MappedTrue
Paralogs
Paralog RepFalse

Un-rearranged Observations

Un-rearranged sequence observations that support this sequence:

AccessionTypeRepositoryStartEnd
HM855893NonlocationalGenBank1330
GRCh38:CM000676.2LocationalGenBank892826893302

Observations in AIRR-seq Repertoires

Click here to review supporting data in VDJbase.

Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.

CDR delineation

CDR1 Start218
CDR1 End241
CDR2 Start293
CDR2 End316
CDR3 Start431

Non-Core Regions

UTR 5' Start
UTR 5' End
L-PART1 Start1
L-PART1 End46
L_PART1ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAG
L-PART2 Start132
L-PART2 End142
L_PART2GAGCCCACTCC
v_rs_start439
v_rs_end477
V_HEPTAMERCACAGTG
V_NONAMERTCAGAAACC

Extension

3' Extension
3' start
3' end
5' start
5' end

Additional Information

Sequence IDA02650
CuratorWilliam Lees
Curator addressBirkbeck College, University of London, Malet Street, London
Version2
Release Date2024-02-23
Release Notes

Base annotation against GRCh38 to obtain leader sequence

LocusIGH
Sequence TypeV
Gene Subgroup1
Gene Designation2
Allele Designation04

Acknowledgements

Individuals acknowledged as contributing to this sequence:

No Items

Notes

Notes are added by IARC reviewers.

Sequence annotation is based on GRCh38:CM000676.2
Leader verified against Huang, Thörnqvist and Ohlin, 2021
VDJbase example haplotype: P1_I27_S1

Attachments

No Items

History

History logs the times and reasons for the publication of each version of this sequence.

William Lees
2023-07-10 11:24:35
Version 1 published

Bulk upload of sequences for the AIRR-C Human IG germline sets

William Lees
2024-02-23 15:09:39
Version 2 published

Base annotation against GRCh38 to obtain leader sequence

Changes from previous version

v1v2
Subgroup typenone
Full Sequence
Gene start28143
Gene end323438
L-PART1 Start1
L-PART1 End46
L-PART2 Start17132
L-PART2 End27142
CDR1 Start103218
CDR1 End126241
CDR2 Start178293
CDR2 End201316
CDR3 Start316431
v_rs_start324439
v_rs_end352477
Codon Frame1
3' Extension
5' Extension
Noteschanged

Versions

All published versions of this sequence.

Sequence NameIMGT NameAlternative namesInference TypeAffirmation LevelSpecies subgroupSubgroup typeVersionDate
IGHV1-2*04IGHV1-2*04Genomic and rearranged112023-07-10
IGHV1-2*04IGHV1-2*04Genomic and rearranged1none22024-02-23