Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGHV1-2*04 |
IUIS Name | IGHV1-2*04 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Unrearranged and Rearranged |
Mapped | True |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
HM855893 | Nonlocational | GenBank | 1 | 330 |
GRCh38:CM000676.2 | Locational | GenBank | 892826 | 893302 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 218 |
CDR1 End | 241 |
CDR2 Start | 293 |
CDR2 End | 316 |
CDR3 Start | 431 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGACTGGACCTGGAGGATCCTCTTCTTGGTGGCAGCAGCCACAG |
L-PART2 Start | 132 |
L-PART2 End | 142 |
L_PART2 | GAGCCCACTCC |
v_rs_start | 439 |
v_rs_end | 477 |
V_HEPTAMER | CACAGTG |
V_NONAMER | TCAGAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02650 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-23 |
Release Notes | Base annotation against GRCh38 to obtain leader sequence |
Locus | IGH |
Sequence Type | V |
Gene Subgroup | 1 |
Gene Designation | 2 |
Allele Designation | 04 |
Gene start | 143 |
Gene end | 438 |
Notes are added by IARC reviewers.
Sequence annotation is based on GRCh38:CM000676.2 |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:35 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-23 15:09:39 | Version 2 published Base annotation against GRCh38 to obtain leader sequence |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 28 | 143 |
Gene end | 323 | 438 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 17 | 132 |
L-PART2 End | 27 | 142 |
CDR1 Start | 103 | 218 |
CDR1 End | 126 | 241 |
CDR2 Start | 178 | 293 |
CDR2 End | 201 | 316 |
CDR3 Start | 316 | 431 |
v_rs_start | 324 | 439 |
v_rs_end | 352 | 477 |
Codon Frame | 1 | |
3' Extension | ||
5' Extension | ||
Notes | changed |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGHV1-2*04 | IGHV1-2*04 | 1 | 2023-07-10 |
IGHV1-2*04 | IGHV1-2*04 | 2 | 2024-02-23 |