Species | Homo sapiens |
Species subgroup | |
Subgroup type | none |
Sequence Name | IGLV2-23*04 |
IUIS Name | IGLV2-23*04 |
Alternative names | |
Affirmation Level | 1 |
Full Sequence | |
Coding Sequence | |
Functionality | ORF |
Inference Type | Genomic Only |
Mapped | False |
Paralogs | |
Paralog Rep | False |
Un-rearranged sequence observations that support this sequence:
Accession | Type | Repository | Start | End |
---|---|---|---|---|
Gibson:NA18508 | Locational | GenBank | 163 | 672 |
Click here to review supporting data in VDJbase.
Clicking the link will take you to VDJbase. Open in a new tab if you want to keep this page open. In VDJbase, click on the count in the Apperances column to see a list of samples in which the sequence was found.
CDR1 Start | 250 |
CDR1 End | 276 |
CDR2 Start | 328 |
CDR2 End | 336 |
CDR3 Start | 445 |
UTR 5' Start | |
UTR 5' End | |
L-PART1 Start | 1 |
L-PART1 End | 46 |
L_PART1 | ATGGCCTGGGCTCTGCTGCTCCTCAACCTCCTCACTCAGGACACAG |
L-PART2 Start | 164 |
L-PART2 End | 174 |
L_PART2 | GGTCCTGGGCC |
v_rs_start | 472 |
v_rs_end | 510 |
V_HEPTAMER | CACAGTG |
V_NONAMER | ACCAAAACC |
3' Extension | |
3' start | |
3' end | |
5' start | |
5' end |
Sequence ID | A02906 |
Curator | William Lees |
Curator address | Birkbeck College, University of London, Malet Street, London |
Version | 2 |
Release Date | 2024-02-22 |
Release Notes | Supporting sequence and annotation updated |
Locus | IGL |
Sequence Type | V |
Gene Subgroup | 2 |
Gene Designation | 23 |
Allele Designation | 04 |
Notes are added by IARC reviewers.
Information for this sequence was imported into OGRDB via bulk update with the following notes: |
History logs the times and reasons for the publication of each version of this sequence.
William Lees 2023-07-10 11:24:46 | Version 1 published Bulk upload of sequences for the AIRR-C Human IG germline sets |
William Lees 2024-02-22 15:35:40 | Version 2 published Supporting sequence and annotation updated |
v1 | v2 | |
---|---|---|
Subgroup type | none | |
Full Sequence | ||
Gene start | 337 | 175 |
Gene end | 633 | 471 |
L-PART1 Start | 1 | |
L-PART1 End | 46 | |
L-PART2 Start | 326 | 164 |
L-PART2 End | 336 | 174 |
CDR1 Start | 412 | 250 |
CDR1 End | 438 | 276 |
CDR2 Start | 490 | 328 |
CDR2 End | 498 | 336 |
CDR3 Start | 607 | 445 |
v_rs_start | 634 | 472 |
v_rs_end | 672 | 510 |
Codon Frame | 1 | |
3' Extension | ||
5' Extension |
All published versions of this sequence.
Sequence Name | IMGT Name | Version | Date |
---|---|---|---|
IGLV2-23*04 | IGLV2-23*04 | 1 | 2023-07-10 |
IGLV2-23*04 | IGLV2-23*04 | 2 | 2024-02-22 |